ID: 1057903761

View in Genome Browser
Species Human (GRCh38)
Location 9:98968759-98968781
Sequence TCAGCTCCTGCAGTTGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057903754_1057903761 30 Left 1057903754 9:98968706-98968728 CCACTGAACCCACTTTAGGGAAC 0: 1
1: 0
2: 2
3: 11
4: 103
Right 1057903761 9:98968759-98968781 TCAGCTCCTGCAGTTGGGCCTGG No data
1057903757_1057903761 21 Left 1057903757 9:98968715-98968737 CCACTTTAGGGAACACAGGCTAT 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1057903761 9:98968759-98968781 TCAGCTCCTGCAGTTGGGCCTGG No data
1057903756_1057903761 22 Left 1057903756 9:98968714-98968736 CCCACTTTAGGGAACACAGGCTA 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1057903761 9:98968759-98968781 TCAGCTCCTGCAGTTGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057903761 Original CRISPR TCAGCTCCTGCAGTTGGGCC TGG Intronic
No off target data available for this crispr