ID: 1057907872

View in Genome Browser
Species Human (GRCh38)
Location 9:98996236-98996258
Sequence CTTTCTAAGCTAAAGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057907872_1057907878 10 Left 1057907872 9:98996236-98996258 CCCAGCCCCTTTAGCTTAGAAAG 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1057907878 9:98996269-98996291 ATCTGAATGCTGACAAGCGCTGG No data
1057907872_1057907879 11 Left 1057907872 9:98996236-98996258 CCCAGCCCCTTTAGCTTAGAAAG 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1057907879 9:98996270-98996292 TCTGAATGCTGACAAGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057907872 Original CRISPR CTTTCTAAGCTAAAGGGGCT GGG (reversed) Intronic
900253979 1:1687279-1687301 CATTCTCCACTAAAGGGGCTGGG + Intronic
903012417 1:20340455-20340477 CTTTCTAAGCCAGAGGTCCTAGG - Intronic
904408962 1:30313399-30313421 CTGTCTATGCTAATGGGGCTGGG - Intergenic
909031753 1:70549349-70549371 CATTCCAAGGTACAGGGGCTAGG + Intergenic
915283201 1:154836720-154836742 GATTGTCAGCTAAAGGGGCTAGG + Intronic
916076083 1:161200678-161200700 GGTTCTAAGCCAACGGGGCTGGG + Intronic
919897392 1:202017920-202017942 CTTTAGAAGCTGAAGAGGCTGGG - Intergenic
924543260 1:245001262-245001284 CTTTATAGGCTAAATGGTCTTGG - Intronic
924748404 1:246860478-246860500 CTTTCTAAGCTGAAGGAGTAAGG + Intronic
1063203837 10:3811756-3811778 CTTGCTAACCTGCAGGGGCTGGG + Intergenic
1063429311 10:5975968-5975990 CTTTCTAAGGTCAAAGGGCAAGG + Intronic
1066762376 10:38768035-38768057 CTTTAAAAGTTAAAGTGGCTGGG + Intergenic
1067188746 10:44052544-44052566 CTTGCTAAGGTAAAGCAGCTAGG + Intergenic
1067542328 10:47165162-47165184 CTTAATAAGAAAAAGGGGCTAGG - Intergenic
1072621650 10:97083751-97083773 CTTTCAAACCTACAGGGGTTTGG - Intronic
1073066784 10:100765343-100765365 CTAACTAAGCCAAAGGGGCAGGG - Intronic
1075649657 10:124119293-124119315 CTTCCTGGCCTAAAGGGGCTTGG - Intergenic
1076480717 10:130783667-130783689 CTTTTCATGCTAAAGGGGGTGGG - Intergenic
1079404244 11:20131067-20131089 TTTTTTAAGAGAAAGGGGCTAGG + Intergenic
1084844596 11:71889083-71889105 CTTTCTAGGCTGAAGTGGCCTGG - Intronic
1085353409 11:75815311-75815333 GTTTCTAGGCTGCAGGGGCTTGG + Exonic
1086883990 11:92182422-92182444 CTTTCTAAACTATATTGGCTTGG - Intergenic
1089770936 11:120802513-120802535 CTCTCCAAGCTTAAGGGTCTTGG - Intronic
1092312467 12:7373449-7373471 CTGTCTTAGATAAAGGGGCGAGG + Exonic
1093160137 12:15737289-15737311 CTTTCTGAACTAAAGTGTCTAGG - Intronic
1095951303 12:47783387-47783409 CTTCCTAGGCTCTAGGGGCTAGG - Exonic
1096195148 12:49644892-49644914 CTTTCTGAGCTTAGGGGGCTAGG - Exonic
1097808647 12:63993171-63993193 CTTTCTAATCTAAAGGGACCTGG - Intronic
1104524890 12:129511575-129511597 CTTTCACAGCCAAAGGTGCTGGG + Intronic
1105523060 13:21148825-21148847 CTTTGTAAGCCAAAGTGGTTGGG + Exonic
1108160242 13:47631751-47631773 CTATATAAGCTAATAGGGCTGGG + Intergenic
1110263095 13:73508206-73508228 CTTACTAAGTTAACAGGGCTTGG - Intergenic
1112066469 13:95798535-95798557 CTTTGTAAGTTAGAGGGGCTCGG - Intergenic
1113053379 13:106239455-106239477 CTTTCTACCCTTAAGGGCCTTGG - Intergenic
1115139860 14:30158278-30158300 CTTTTCAAGCTAGAGGTGCTAGG + Intronic
1125007398 15:34833195-34833217 CATTCTTGGCTGAAGGGGCTAGG + Intergenic
1126033690 15:44526780-44526802 CTGTGTGAGCTGAAGGGGCTGGG - Exonic
1126517880 15:49556412-49556434 ATTTCTAACCTCAAGGGGCCAGG - Intronic
1126730999 15:51682083-51682105 CTTTTTCACCTAAAGTGGCTTGG + Intronic
1127134861 15:55909626-55909648 CTTTGTAGGCTGAAGGGGCTTGG - Intronic
1127491791 15:59472106-59472128 CCTTTTTAGCTAAAGGGGGTTGG + Intronic
1129384420 15:75188129-75188151 CACTCTATGCTGAAGGGGCTGGG - Intergenic
1130967921 15:88710846-88710868 CTTTCAAAGGCCAAGGGGCTGGG - Intergenic
1133851446 16:9508030-9508052 CTTTCTTAGCTTAAGTGACTAGG + Intergenic
1137277825 16:46948571-46948593 CTTTCCATGTAAAAGGGGCTTGG - Intergenic
1137456275 16:48620335-48620357 CTTTCAAACATGAAGGGGCTGGG - Intergenic
1149789039 17:59461356-59461378 CTTTCTAAAATAAATGGGTTAGG - Intergenic
1150946597 17:69753091-69753113 CTTTCTCTGCTAAAGGACCTGGG + Intergenic
1158353675 18:56592327-56592349 CTTTAAAAGCAAAAGGGGCAAGG + Intergenic
1158989603 18:62855008-62855030 CTTTTTAAACTAAATGGCCTTGG + Intronic
1164098941 19:22037040-22037062 CTTTCTAAGATTTAGGGGGTTGG + Intergenic
925843242 2:8012031-8012053 CTTTCTTAGTTTGAGGGGCTTGG - Intergenic
925913230 2:8586817-8586839 GATTCAAAGCCAAAGGGGCTGGG + Intergenic
926598485 2:14816140-14816162 CTGTGTAAGCTAAAGGAGTTTGG - Intergenic
930036471 2:47088569-47088591 CTCTCTAAGACAAAGAGGCTTGG + Intronic
933029450 2:77309518-77309540 CCTTCTCAGCCAAAGGGTCTTGG - Intronic
934464045 2:94243273-94243295 CTTTATAAGTTAAACTGGCTGGG + Intergenic
935198260 2:100833794-100833816 CTTTTTTATCTAAAGAGGCTTGG + Intronic
940813430 2:158271933-158271955 ATTTCTAAGCTAAAGTAGTTAGG - Intronic
941199348 2:162490288-162490310 ATATCTAAGCTGATGGGGCTGGG - Intronic
941200017 2:162496455-162496477 ATATCTAAGCTGATGGGGCTGGG - Intronic
941623113 2:167800863-167800885 CTGTCAAAGCTAAATGAGCTTGG - Intergenic
942707604 2:178794229-178794251 CTTTCTGAGCAAAAGGTGGTCGG - Intronic
943596676 2:189866149-189866171 CTTTCTTACCTAAAAGAGCTAGG + Intronic
947393659 2:229666004-229666026 TTTTCAGAGCTAAATGGGCTTGG + Intronic
948929718 2:241124235-241124257 CTTTCTAACTTAAAGCTGCTGGG - Intronic
1170080006 20:12464269-12464291 CTTTCTGAGATAAGGGTGCTGGG + Intergenic
1171354068 20:24530136-24530158 CTTACAAAGCTAAAGGGAGTTGG + Intronic
1184235316 22:43180128-43180150 CTAGCTTAGCTAAAGGGCCTGGG - Intronic
1184295244 22:43519412-43519434 GTTTCTAAGTAAAAGGAGCTAGG - Intergenic
949661568 3:6284672-6284694 CTTTCTCATCTGAAAGGGCTGGG - Intergenic
950874680 3:16260781-16260803 CTTTGTTGGCTGAAGGGGCTGGG + Exonic
951357364 3:21684191-21684213 CTTTATAAACTAAAGGGGCCAGG - Intronic
955012166 3:55028571-55028593 CTTTCTTGGCAAAGGGGGCTGGG - Intronic
956935961 3:74102197-74102219 CTTTCTGATCCAAATGGGCTTGG - Intergenic
957955988 3:87187631-87187653 CTTTCCAAGCATATGGGGCTGGG + Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
963030591 3:140970948-140970970 CTTTATAAGCCAAATGGGGTTGG - Exonic
964861489 3:161207276-161207298 CTCTCCAAGCTAAAGCAGCTTGG + Intronic
966736190 3:183189009-183189031 CTTTCTAACCTGAAGGGGTCTGG + Intronic
967835906 3:193962395-193962417 CTTTCAAAGCATGAGGGGCTAGG - Intergenic
969420325 4:7090637-7090659 CCTTCTAAGATTTAGGGGCTTGG - Intergenic
969420333 4:7090672-7090694 CCTTCTAAGATTTAGGGGCTTGG - Intergenic
969420341 4:7090707-7090729 CCTTCTAAGATTTAGGGGCTTGG - Intergenic
969420349 4:7090742-7090764 CCTTCTAAGATTTAGGGGCTTGG - Intergenic
969420357 4:7090777-7090799 CCTTCTAAGATTTAGGGGCTTGG - Intergenic
971276889 4:25207031-25207053 CTTTTTCAGGTTAAGGGGCTGGG - Intronic
973318867 4:48789710-48789732 TTTTCTAATCTTAAGGGGCCAGG - Intergenic
973661639 4:53113258-53113280 CTTCCTAACTTACAGGGGCTAGG - Intronic
979770478 4:124518735-124518757 TTTTCTAAGCAAAAGGCACTAGG + Intergenic
982738389 4:159031158-159031180 CTTTCTAACCTATTGGAGCTTGG - Intronic
983712120 4:170731273-170731295 CTTTCCTACCTGAAGGGGCTGGG - Intergenic
988335728 5:29906434-29906456 CTTGCTGAGCTTAAGGGCCTGGG + Intergenic
989194791 5:38706308-38706330 CTTTCATACCTAAAGGGGCCTGG - Intergenic
991066551 5:62430615-62430637 CTTTCTGAGATTAAGGGGCCTGG - Intronic
992857679 5:80879730-80879752 GTTTCTAAGCTGAAGGAGTTTGG - Intergenic
993806329 5:92415259-92415281 CTTTCTAAACTATATGGCCTTGG + Intergenic
995197089 5:109383186-109383208 CTTTCCAAGCTAAATGGGTATGG + Intronic
999119082 5:149195141-149195163 ATTTGTAAGATGAAGGGGCTGGG - Intronic
1000681763 5:164193988-164194010 CTTCCTAAGCTATAGGCTCTAGG + Intergenic
1002296788 5:178235842-178235864 CTTGCTAAGCAGAAGAGGCTCGG - Intergenic
1003627269 6:7753427-7753449 GTTTCTAATCTAAAGGTGCCTGG - Intronic
1003749937 6:9043693-9043715 CTTTCAAAGCTATGGGGGCAGGG - Intergenic
1003936255 6:10977823-10977845 CTTGCTCAGCTCATGGGGCTGGG - Intronic
1004799387 6:19129488-19129510 CTGTCTAAGCTAAAGGGCCAAGG + Intergenic
1007190003 6:40005826-40005848 CCACCTAAGCAAAAGGGGCTAGG + Intergenic
1009909576 6:69909190-69909212 CTTTCTAAGGAAAAGAGGGTAGG + Intronic
1015107716 6:129556345-129556367 CTTCCTAAGCTTAAAGGGCATGG + Intergenic
1015244382 6:131061668-131061690 GTTTCTATGCTGCAGGGGCTAGG - Intronic
1015707382 6:136102881-136102903 CATTCTAAGCTAAAGATGCAAGG + Intronic
1016449293 6:144164990-144165012 CTTTTTAAGCTATATAGGCTGGG - Intronic
1021765764 7:23947362-23947384 CTTGCGAAGCACAAGGGGCTAGG + Intergenic
1022040937 7:26580490-26580512 CCTTATAAGCTTCAGGGGCTGGG + Intergenic
1022900036 7:34798528-34798550 CTGTCTAAGAAAAAGGGGCGGGG + Intronic
1026657043 7:72265836-72265858 CTTTCTAAACTACAAAGGCTGGG + Intronic
1029236978 7:99128675-99128697 CTTTCTAAACTGAATGTGCTGGG + Intronic
1038781174 8:30569356-30569378 CTGTCAAAGCTAAAGTGGCCTGG + Intronic
1041822580 8:62054449-62054471 CTATCTAACCTAAAGGGGGCAGG + Intergenic
1042444388 8:68867137-68867159 CAATGTAAGCTAAAGGGGCCTGG + Intergenic
1043365634 8:79530253-79530275 CATTCTGAGGTAAAGGGGTTAGG + Intergenic
1045687438 8:104726803-104726825 ATTTCTAACAAAAAGGGGCTGGG - Intronic
1051019562 9:12525796-12525818 CTTTCTAAGGGAAAGGGGGAAGG + Intergenic
1051727234 9:20100857-20100879 CTTTCCAAGATAAAAGGGCCAGG - Intergenic
1053941127 9:43250478-43250500 CTTTATAAGTTAAACTGGCTGGG + Intergenic
1057907872 9:98996236-98996258 CTTTCTAAGCTAAAGGGGCTGGG - Intronic
1058582896 9:106478394-106478416 TTTTCTGGGCAAAAGGGGCTGGG + Intergenic
1061070204 9:128305245-128305267 CTTTCACAGCCAAAGGGCCTGGG - Intergenic
1188415780 X:29932245-29932267 CTTTATAATCTAAAGGGGAAAGG + Intronic
1189644047 X:43107056-43107078 CTATCTAACCTCAAAGGGCTGGG - Intergenic
1195694687 X:107658222-107658244 CTTTCTAACCTAAGGTGCCTAGG - Intergenic
1198585647 X:138117650-138117672 CTTTAAAAGCTAAAGTTGCTGGG - Intergenic
1199509110 X:148600170-148600192 CTTTCCAAGCTAAGGAGACTTGG + Intronic