ID: 1057909005

View in Genome Browser
Species Human (GRCh38)
Location 9:99003924-99003946
Sequence TCGGGGGCACAGAAGTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057908994_1057909005 14 Left 1057908994 9:99003887-99003909 CCCTGGGAGCACTGAAAAAGGGG 0: 1
1: 0
2: 2
3: 22
4: 196
Right 1057909005 9:99003924-99003946 TCGGGGGCACAGAAGTTTCCTGG No data
1057909002_1057909005 -10 Left 1057909002 9:99003911-99003933 CCAGAGCCCAGACTCGGGGGCAC 0: 1
1: 0
2: 2
3: 18
4: 201
Right 1057909005 9:99003924-99003946 TCGGGGGCACAGAAGTTTCCTGG No data
1057909001_1057909005 -9 Left 1057909001 9:99003910-99003932 CCCAGAGCCCAGACTCGGGGGCA 0: 1
1: 0
2: 2
3: 17
4: 199
Right 1057909005 9:99003924-99003946 TCGGGGGCACAGAAGTTTCCTGG No data
1057908996_1057909005 13 Left 1057908996 9:99003888-99003910 CCTGGGAGCACTGAAAAAGGGGC 0: 1
1: 0
2: 0
3: 16
4: 162
Right 1057909005 9:99003924-99003946 TCGGGGGCACAGAAGTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057909005 Original CRISPR TCGGGGGCACAGAAGTTTCC TGG Intronic
No off target data available for this crispr