ID: 1057911272

View in Genome Browser
Species Human (GRCh38)
Location 9:99022160-99022182
Sequence GTGTGTGTGACAAGCCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 241}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057911272_1057911276 -7 Left 1057911272 9:99022160-99022182 CCATCCAGGCTTGTCACACACAC 0: 1
1: 0
2: 2
3: 22
4: 241
Right 1057911276 9:99022176-99022198 CACACACAGGTGTAAGACCAGGG 0: 1
1: 0
2: 0
3: 22
4: 195
1057911272_1057911275 -8 Left 1057911272 9:99022160-99022182 CCATCCAGGCTTGTCACACACAC 0: 1
1: 0
2: 2
3: 22
4: 241
Right 1057911275 9:99022175-99022197 ACACACACAGGTGTAAGACCAGG 0: 1
1: 0
2: 0
3: 25
4: 174
1057911272_1057911277 -1 Left 1057911272 9:99022160-99022182 CCATCCAGGCTTGTCACACACAC 0: 1
1: 0
2: 2
3: 22
4: 241
Right 1057911277 9:99022182-99022204 CAGGTGTAAGACCAGGGATGCGG 0: 1
1: 0
2: 3
3: 23
4: 266
1057911272_1057911279 15 Left 1057911272 9:99022160-99022182 CCATCCAGGCTTGTCACACACAC 0: 1
1: 0
2: 2
3: 22
4: 241
Right 1057911279 9:99022198-99022220 GATGCGGCCAAAACAGCCACAGG 0: 1
1: 0
2: 0
3: 5
4: 57
1057911272_1057911280 21 Left 1057911272 9:99022160-99022182 CCATCCAGGCTTGTCACACACAC 0: 1
1: 0
2: 2
3: 22
4: 241
Right 1057911280 9:99022204-99022226 GCCAAAACAGCCACAGGCTGAGG 0: 1
1: 0
2: 2
3: 24
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057911272 Original CRISPR GTGTGTGTGACAAGCCTGGA TGG (reversed) Intronic
900092744 1:927517-927539 GGGTGTGGGACAGGCCTGGGAGG - Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
901177300 1:7313810-7313832 GTGCCTGTGAAAAGGCTGGAAGG + Intronic
903298960 1:22364377-22364399 CTCTGGGTGACAAGCCTGGCCGG - Intergenic
903642282 1:24868210-24868232 GTGTCTGGGACAAGCCTGGAAGG + Intergenic
905335918 1:37244424-37244446 CTGTCTGTGACAAGACGGGAGGG - Intergenic
906316211 1:44787779-44787801 GTGTGTGAGACCAGAGTGGAAGG - Intergenic
906318682 1:44803805-44803827 CTGTGTGTCACCAGCCTGGCGGG + Intronic
906521266 1:46468472-46468494 GTGTGTGTGACAAGAGTGGTGGG - Intergenic
909730921 1:78888357-78888379 GTGTGTGAGACAAGCATGAAAGG + Intergenic
910656701 1:89626948-89626970 GTGTGTGTGTCTAGACTAGAGGG - Intergenic
911128026 1:94359469-94359491 GGGTATGTGAAAAGCCTGGTAGG - Intergenic
913257315 1:116965138-116965160 GTGTATTTGAGGAGCCTGGAAGG - Intronic
916069582 1:161162030-161162052 GAGTGTGTGATGAGCCTGGAAGG - Exonic
916203177 1:162290762-162290784 GTTAGTGTGACAAGCTGGGAGGG + Intronic
916211708 1:162365098-162365120 GTGTGTGTGGCAGGTCTAGAGGG + Intronic
918260093 1:182787914-182787936 GTGTGTGTGAAGAGGCAGGAGGG - Intergenic
920120061 1:203649872-203649894 GCGAGTGTGACATGCCTGGCCGG - Intronic
920698902 1:208203083-208203105 GTGTGTGTGTCAAGACGGGTGGG + Intronic
921736344 1:218633227-218633249 GTGTGTCTGACAACCCTTGTTGG + Intergenic
924554432 1:245106832-245106854 GTGTTTGAGACCAGCCTGGCTGG + Intronic
1062824916 10:560043-560065 GTGTCTGTGACAGGGCAGGAGGG - Intronic
1064155905 10:12902966-12902988 GTGAATGTGAAAAGCGTGGATGG + Intronic
1065204136 10:23342205-23342227 GTGTGTGTGGCAAGTGGGGAGGG - Intronic
1067234829 10:44438854-44438876 GTGTGTGTCACATGCATTGAGGG - Intergenic
1067723389 10:48747812-48747834 GTTTCTGTGACAATCATGGAAGG + Intronic
1069692734 10:70364384-70364406 CTGTGTGTGCCCTGCCTGGAGGG - Intronic
1072618562 10:97065393-97065415 GTGTGTGTGACAAGCATGCCAGG + Intronic
1075017973 10:118924872-118924894 GTGGGTGTGACCAGGCTGGATGG - Intergenic
1075659899 10:124185976-124185998 CTGTGTGGGACATGACTGGAAGG - Intergenic
1076349393 10:129805425-129805447 GTGAGTGGGACCAACCTGGACGG - Intergenic
1078267235 11:9764393-9764415 GTGTTTTTGACAAACCAGGAGGG - Intergenic
1080268653 11:30426971-30426993 GCGTGTGTCACATGCCTGGCTGG + Intronic
1081716497 11:45254269-45254291 TTGTTTGTGACTCGCCTGGAAGG - Exonic
1082672515 11:56053064-56053086 GAGTTTGAGACAAGCCTGGCCGG + Intergenic
1082820116 11:57538922-57538944 CTATTTGTGACAAGCCTGGAGGG + Intergenic
1083227466 11:61294228-61294250 GTGTGAGCTACAAGCCTGGCCGG + Intronic
1084795275 11:71501138-71501160 GTGTGCTGGAAAAGCCTGGAGGG - Intronic
1088906115 11:114156574-114156596 TTCTGTGTCATAAGCCTGGAGGG - Intronic
1089640110 11:119842479-119842501 GTGTGTGTGTGAAGGATGGAGGG - Intergenic
1089920321 11:122203354-122203376 GTGTGAGTAATAAGCCTGCATGG + Intergenic
1092259192 12:6943413-6943435 GTGGGTGATAAAAGCCTGGAAGG + Intronic
1092458085 12:8662546-8662568 GTGTGTGTGAAAGGGCTGGAGGG - Intronic
1093073141 12:14728278-14728300 GTGTATGTTAAAAGCCTGTAGGG + Intergenic
1093505148 12:19856502-19856524 TTTTGTGTGACGAGCATGGACGG + Intergenic
1093880652 12:24400733-24400755 GTGTGTGTGTGGAGCATGGAGGG - Intergenic
1095320318 12:40819123-40819145 GTGTGTCTGACAACCCCGGTTGG + Intronic
1096608971 12:52788687-52788709 GGCAGTGTGACATGCCTGGAAGG + Intergenic
1096689206 12:53309134-53309156 GTGAGTGGGACAAGGATGGAGGG - Intronic
1098652901 12:72995976-72995998 AAGTGTGTCAAAAGCCTGGAAGG - Intergenic
1100926857 12:99558445-99558467 GTGTGTGTGTCAAGGGGGGAGGG + Intronic
1101592657 12:106138391-106138413 GTGAGTGGGGCAATCCTGGAGGG - Intronic
1103889042 12:124224787-124224809 GTGAGTGTGACAGGCCCGAAAGG + Intronic
1105882729 13:24617962-24617984 GTGTGTGTCAAGAGACTGGAAGG - Intergenic
1108477479 13:50835290-50835312 GTGTGGGAGACAAGACTGGCAGG + Intronic
1109259548 13:60127706-60127728 GTGTTTGTCAAAAGCCAGGATGG + Intronic
1111993489 13:95139512-95139534 GTGTAGGTGCCAAGGCTGGAGGG - Intronic
1113604411 13:111595202-111595224 GTGAGTGTGACAGCACTGGAGGG + Intronic
1113604417 13:111595242-111595264 GTGAGTGTGACAGCACTGGAGGG + Intronic
1113604423 13:111595282-111595304 GTGAGTGTGACAACACTGGAGGG + Intronic
1113755868 13:112810238-112810260 GTGGATGTGAAGAGCCTGGAAGG + Intronic
1114670582 14:24408817-24408839 GGGTGTGTGCCCACCCTGGAAGG + Exonic
1115088493 14:29546117-29546139 ATGTGTGTGTAAAGCCTGAAAGG + Intergenic
1115402314 14:32976053-32976075 GTGTGTGTGAAAATCCTTCAGGG + Intronic
1119028626 14:71174231-71174253 GTGTGTCTGAAAAGACTGCAGGG - Intergenic
1120333836 14:83128138-83128160 TTGTGAGTGCCAAGCCAGGATGG + Intergenic
1122943344 14:104993367-104993389 GTGTGGATGACGAGGCTGGAAGG + Intronic
1125786502 15:42322966-42322988 CTGTCTGTGAAAAGCCTGGTGGG - Intronic
1126507003 15:49416746-49416768 GTGTGTGTGGCAATTGTGGATGG - Intronic
1127270050 15:57392316-57392338 CTGTGTGTGATCAGCCTAGAGGG + Intronic
1128165911 15:65464474-65464496 GAGTTTGTGACCAGCCTGGGTGG + Intronic
1128251930 15:66169838-66169860 GTGTATGTGACCTGCCGGGATGG - Intronic
1128511927 15:68318711-68318733 GTGTGTGTGGCAAGCAAGGGGGG + Intronic
1128754821 15:70174619-70174641 GTGTGAGTGACAACTCAGGAGGG + Intergenic
1129348525 15:74939760-74939782 GTTTCTGTGGCATGCCTGGAGGG - Intergenic
1129937135 15:79460187-79460209 GTGAGAGTCACAAGCCAGGAAGG - Intronic
1132279995 15:100603967-100603989 TTGTGTGTGACAAATGTGGATGG + Intronic
1132403896 15:101530731-101530753 ATGTGGATTACAAGCCTGGAAGG + Intergenic
1134131936 16:11655977-11655999 GGGTGTGGGCCAGGCCTGGAAGG - Intergenic
1134410621 16:14000648-14000670 CTGTGTGTACCCAGCCTGGATGG - Intergenic
1139282730 16:65784416-65784438 GTGTGTGTGAGGAGCCTTGGGGG - Intergenic
1139381845 16:66537390-66537412 GTGGGTGGGAGAAGCCAGGAGGG + Intronic
1139952329 16:70678446-70678468 GTGGGTGTGGCAAGCCAGGCTGG - Intronic
1143588230 17:7862853-7862875 GTCAGGGAGACAAGCCTGGAGGG + Intronic
1145020890 17:19429814-19429836 GTGTGTGTGAGAAAGCTGGCTGG - Intergenic
1145144566 17:20469705-20469727 GAGTTTGAGACAAGCCTGGGCGG + Intergenic
1145830535 17:27912766-27912788 GTGTGTGTGGCAGGACAGGAGGG - Intergenic
1148172719 17:45536597-45536619 GTGCAAGTGAGAAGCCTGGAAGG + Intergenic
1148172912 17:45538347-45538369 GAGTTTGAGACCAGCCTGGAGGG + Intergenic
1148276552 17:46308852-46308874 GTGCAAGTGAGAAGCCTGGAAGG - Intronic
1148298669 17:46526440-46526462 GTGCAAGTGAGAAGCCTGGAAGG - Intronic
1148363202 17:47030937-47030959 GTGCAAGTGAGAAGCCTGGAAGG - Intronic
1149517185 17:57289550-57289572 GTCTGTAAGACGAGCCTGGAAGG + Intronic
1150403924 17:64883517-64883539 GTGCAAGTGAGAAGCCTGGAAGG + Intronic
1150691234 17:67368898-67368920 GTGTGTTTTAGAAGCCTGCAGGG - Intergenic
1151004564 17:70419248-70419270 GTTTGTGTAACAATCCTGCAAGG + Intergenic
1152851608 17:82639810-82639832 GTGTGTGTGTCAGGTCGGGAGGG + Intronic
1154225240 18:12497496-12497518 GAGTGTGTGGCAAGCCTGCTGGG + Intronic
1156194719 18:34761115-34761137 GTGTGTGTGTGAAGGATGGAGGG - Intronic
1156464365 18:37339448-37339470 ATGTGTGTGCAAAGCCTGAAAGG + Intronic
1157047286 18:44117479-44117501 GTGTGTGTGTAAAACCTAGAAGG - Intergenic
1159575136 18:70166631-70166653 ATGTGTGTGAATAGTCTGGATGG + Intronic
1160479684 18:79227376-79227398 GTGTGTGTGAATTGCATGGATGG + Intronic
1161023554 19:2023691-2023713 CTGTGTGTGAAAAGCCATGAAGG + Intronic
1161331284 19:3688883-3688905 GTGTTGGGGACAAGGCTGGAAGG - Intronic
1161657756 19:5526264-5526286 CTGTGTGTGAGAAGCCTGAGGGG + Intergenic
1163119391 19:15207871-15207893 GAGTTTGAGACCAGCCTGGACGG - Intergenic
1163505226 19:17701813-17701835 GTGAGTGTGAAATGCCTGCAAGG + Intergenic
1163660310 19:18573113-18573135 GGGTGTGTGAGAAGCCTAGCAGG + Intronic
1163926298 19:20347245-20347267 GTGTGTCTGTGAAGCCTAGATGG - Intergenic
1165937116 19:39396059-39396081 GTGGGTGTGACAGCCCTGGGAGG + Intronic
1167215269 19:48160389-48160411 GTGGGTGTGGGAAGCCAGGATGG + Intronic
1168189874 19:54730111-54730133 CTGTGGGTGACAGGCCAGGATGG - Intronic
1168191873 19:54744411-54744433 GTGTGGGTGAGAGGCCAGGATGG - Intronic
1168196204 19:54775781-54775803 GTGTGGGTGAGAGGCCAGGATGG - Intronic
1168204565 19:54840023-54840045 GTGTGGGTGAGAGGCCAGGAAGG - Intronic
1168206810 19:54856236-54856258 GTGTGGGTGAGAGGCCAGGATGG - Intronic
927403895 2:22746397-22746419 GGGTGTGTGCCAAGCATGGTGGG - Intergenic
930253296 2:49060465-49060487 GGGTGTGTGACCACCCTGGCTGG - Intronic
933820822 2:86110656-86110678 GTGTGTGTGACAGTCCTCCATGG + Intronic
934601457 2:95661736-95661758 GTGTGTGTGAGAGGGGTGGAGGG + Intergenic
935057173 2:99577637-99577659 GTGTCAAGGACAAGCCTGGAAGG - Intronic
935710410 2:105893331-105893353 GTGTGGGTGTGAGGCCTGGATGG - Exonic
936331892 2:111554178-111554200 GGGTTTGAGACCAGCCTGGAGGG - Intergenic
936534821 2:113303904-113303926 GTGTGTGTGAGAGGGGTGGAGGG + Intergenic
936754935 2:115696360-115696382 TTGTATGTGACAAGCGAGGAGGG - Intronic
937550868 2:123088786-123088808 GTGTGTGTGATTACACTGGATGG - Intergenic
937925734 2:127166176-127166198 GGGTGTGAGACCATCCTGGAGGG - Intergenic
938097436 2:128472912-128472934 GTGTGCGTGAGAAGCCTGCAAGG + Intergenic
938236845 2:129712262-129712284 ATGTGTGTGACAAGCGTTGCAGG - Intergenic
939097467 2:137851020-137851042 GTGTGTGTGAGGAGGCAGGACGG + Intergenic
939816555 2:146904252-146904274 GTGTGTTTAACAAGCCTTCATGG - Intergenic
941855225 2:170224041-170224063 GTCTGTTTGACAAGCAGGGATGG + Intronic
942501598 2:176596608-176596630 TTGGGTGTGAGTAGCCTGGAAGG - Intergenic
943223521 2:185140124-185140146 GTGCATGTCACAAGCCTTGATGG - Intergenic
944207269 2:197169754-197169776 GTGTGTATCAGAATCCTGGAAGG - Intronic
944360160 2:198844735-198844757 AAGTGTGAGACAAGACTGGAGGG - Intergenic
946660857 2:221997922-221997944 GTGTGGGCTACAAGCATGGATGG + Intergenic
1169194598 20:3676346-3676368 GTTTGTCTGACCTGCCTGGAAGG - Intronic
1169558095 20:6769991-6770013 GTGAGTGTGCCAAGCCAGGAGGG + Intronic
1169591215 20:7144793-7144815 GTTTGTGGGACAAGCCAAGAAGG - Intergenic
1169912874 20:10661556-10661578 GTGTGTAAGACAAGGCTGGCAGG + Intronic
1170125431 20:12957998-12958020 GTGTGTGTGGCAAGGGTGCAGGG - Intergenic
1170613338 20:17931079-17931101 GTGTGGGAAACAAGCCTGAAGGG + Intergenic
1173588415 20:44203679-44203701 GTGTGTGAAAAAAGTCTGGAAGG - Intronic
1173747356 20:45448083-45448105 GTGAGTTTGCCAAGCCTGGAGGG - Intergenic
1174402634 20:50284098-50284120 GTGTGTGTGACGAGGCTGCACGG - Intergenic
1175523855 20:59620045-59620067 GTGAGTGTGAGAAGCCAGGGAGG - Intronic
1178440606 21:32595085-32595107 GTGTGTATGACAAGCCATGTGGG + Intronic
1181158053 22:20937155-20937177 GTGTGGGTGAGAAAGCTGGAAGG - Intronic
1181466605 22:23113816-23113838 CTCTGTGTGACAGGCCTGGTGGG - Intronic
1183453947 22:37911383-37911405 GAGTGTGTGACACACCTGCAGGG + Intronic
1183536450 22:38404341-38404363 GTGTGTGTGCCAGGCCTTGGGGG - Intergenic
1183673390 22:39286276-39286298 GTGTGTGTGCCAAGCACAGAGGG + Intergenic
1185325755 22:50225168-50225190 CTGTGTGTGCCCACCCTGGAAGG + Intronic
949353736 3:3155022-3155044 GTGAGTGAGAAAAGGCTGGAAGG - Intronic
949405884 3:3713900-3713922 GTGTGGGAGACAAGTATGGATGG - Intronic
951354620 3:21649263-21649285 GTGGGTGATACAAGGCTGGAAGG + Intronic
951682700 3:25311129-25311151 GGGTTTGTGCCAAGCCTTGAAGG + Intronic
952814502 3:37435544-37435566 GTGTGTGTAAAAGGGCTGGAAGG + Intergenic
953542822 3:43837173-43837195 GCCTGTAAGACAAGCCTGGAGGG + Intergenic
953747121 3:45583575-45583597 GTGTGTGTCCCAAAGCTGGAGGG - Intronic
953909408 3:46884097-46884119 GTGTGTGTGTGAGGGCTGGAGGG - Intronic
954176435 3:48848979-48849001 GGGTGTGTGCCAAGCCTGTATGG - Intergenic
954456481 3:50602431-50602453 GTGGGTGAGACAGTCCTGGAGGG + Intergenic
955053076 3:55431163-55431185 GTGTGTGTGGCTTGCCAGGAGGG - Intergenic
961311673 3:126006103-126006125 GTGTGTATGAGAAACCTGGAGGG + Intergenic
961520437 3:127464602-127464624 GAGTGTGTGCCAAGGCAGGATGG + Intergenic
962068524 3:132009365-132009387 GGGTGTTTAACAAGCATGGAGGG - Intronic
963571124 3:146997523-146997545 GTGTGTGTGTACAGCCTGGCTGG + Intergenic
966643916 3:182221269-182221291 GTGTCTCTTAAAAGCCTGGAAGG - Intergenic
966748462 3:183300265-183300287 CTGTGTGCTCCAAGCCTGGAGGG + Intronic
967423406 3:189298702-189298724 GTGTGTGTGGAAAACCTAGAGGG + Intronic
968604123 4:1523565-1523587 GTGGGTGTGGGAAGCATGGAGGG - Intergenic
969365937 4:6694324-6694346 GTATTTGTGACAGGCCTGGTGGG + Intronic
970739657 4:19220744-19220766 GTATGTGTGACAAGGCAGTAGGG - Intergenic
971193413 4:24448756-24448778 GTGTGTGAGACATGCAGGGAGGG - Intergenic
975847064 4:78535897-78535919 GTCAGTGTGACAAGAGTGGAGGG - Intronic
976350864 4:84058327-84058349 GTGTGTTTGAGAAGCCTGAAAGG + Intergenic
977293350 4:95186935-95186957 GTGTGTGACTCAAGGCTGGATGG - Intronic
977668221 4:99665678-99665700 GAGTGAGTGACAAGGCTGAAAGG - Intergenic
980197445 4:129608976-129608998 GGGTGTGGGCCATGCCTGGAAGG - Intergenic
980982451 4:139666126-139666148 GTGTGTGTGACAAGGCTTGCGGG + Intronic
982578870 4:157153081-157153103 GTGTATGTGACAAGTTTTGATGG + Intronic
985640079 5:1059478-1059500 GTGTGTGATACCAGCCTGGTGGG + Intronic
987335364 5:16893930-16893952 GAGTGTGTGACAAGCCAGCCAGG + Intronic
988817258 5:34846701-34846723 GTGTGTGTATCCATCCTGGAAGG + Intronic
989262487 5:39433798-39433820 GTGTGTGGGCCAAGGGTGGAGGG - Intronic
989401473 5:41012178-41012200 GTGTGGGAGAAAAGCCTGAAGGG + Intronic
989677201 5:43985753-43985775 GTGTGTGTGAAAAACCAGGCTGG + Intergenic
993178081 5:84514480-84514502 GTGTGTGTGACAATTGTGAATGG + Intergenic
993229240 5:85210680-85210702 GTATGTCCGACAAGCCTGGCAGG - Intergenic
993288126 5:86028313-86028335 GTGTGTGTGTAAAGACTGGGAGG - Intergenic
993734761 5:91463369-91463391 GTGTGTGTGACAATTGTGAATGG - Intergenic
994957872 5:106557989-106558011 GTGTGTGTGTCAAGGGTTGAAGG - Intergenic
996165084 5:120213511-120213533 GTGTGTATTACATCCCTGGAAGG - Intergenic
999247360 5:150162270-150162292 GTGTGTGAGAGCAGCCTGGAGGG + Intergenic
1000986811 5:167869472-167869494 GTGTGGGTGATAAGTGTGGAAGG + Intronic
1002963228 6:1937160-1937182 GAGTGTTCCACAAGCCTGGATGG - Intronic
1003333000 6:5145118-5145140 GTGTGTGTGAAATGCCAGGTTGG - Intronic
1004902140 6:20204675-20204697 GTGTGTGTGCAGAGGCTGGAGGG + Intronic
1005672896 6:28124906-28124928 ATATGTGTGCCAACCCTGGAAGG - Intronic
1006216742 6:32450127-32450149 GTGTGTGTGGCAATCGTGAATGG + Intergenic
1007234392 6:40379829-40379851 GTATGTGGGACTAGCCTGGCTGG - Intergenic
1011099930 6:83709202-83709224 GTGTGTGTGAGTAGCTGGGAGGG - Exonic
1013681717 6:112531400-112531422 GTGTGTGTGTCATACTTGGATGG - Intergenic
1014912654 6:127112909-127112931 GGGTATGTTACAAGCCAGGAAGG - Intergenic
1017032505 6:150236643-150236665 GTGTGTGTGTTTAGCCAGGAGGG + Intronic
1018457587 6:163965637-163965659 GCCTGTGTGACATGTCTGGATGG + Intergenic
1018824717 6:167400407-167400429 GTGTGTATGACAAGCCATGTGGG + Intergenic
1018976966 6:168573532-168573554 GTCTGTGTGTCCAGCCTGGGAGG + Intronic
1019326655 7:441773-441795 GTGGGTGTGGCGAGCGTGGAGGG - Intergenic
1020098723 7:5382575-5382597 GTGTTGGTGACAAGCCTGCTGGG - Intronic
1023137269 7:37065098-37065120 GTGTGTGTTAGAACCCTGGCTGG - Intronic
1023422998 7:40003775-40003797 GTGTGTCTGTCAAGCTTGGTGGG - Intronic
1024710463 7:52009663-52009685 GTGTGTGTGTGAAGCCAGGAAGG + Intergenic
1034293461 7:149950284-149950306 GTGTATTTCACAAGCCTGCAGGG + Intergenic
1034812604 7:154146569-154146591 GTGTATTTCACAAGCCTGCAGGG - Intronic
1038781679 8:30573445-30573467 GTGCAAGTGACAAGTCTGGATGG + Intergenic
1039304643 8:36248331-36248353 GAGTTTGAGACCAGCCTGGATGG + Intergenic
1039827773 8:41189480-41189502 GTGTGTGTGTCAAACCCGGGAGG + Intergenic
1041740212 8:61150120-61150142 GTGTGTGTGACTCTCCTGCAAGG + Intronic
1043160970 8:76846891-76846913 TTGTGTGTGACAGTCCTTGATGG + Intronic
1045319120 8:101068289-101068311 CTGGGTGAGACAGGCCTGGAGGG + Intergenic
1047556643 8:125939171-125939193 GTGTGGGTGACCTTCCTGGAGGG - Intergenic
1047925205 8:129676016-129676038 GTGTGTCTGACAAGCCTGCATGG + Intergenic
1049409903 8:142468254-142468276 GTGTGTGTGACATGCATGCACGG + Intronic
1049415795 8:142494459-142494481 GTGTGTGTCACATGCTTGTAGGG + Intronic
1049563110 8:143322617-143322639 GTGTGTGTGACGTGCCTGTGTGG - Intronic
1050531040 9:6589630-6589652 GAGTTTGTGACCAGCCTGGGCGG - Intronic
1050692240 9:8241082-8241104 GCGTGTGTGACAAAGATGGATGG + Intergenic
1053681953 9:40491450-40491472 GTGTGTGTGGCAAGTCTGCTGGG - Intergenic
1053931943 9:43119780-43119802 GTGTGTGTGGCAAGTCTGCTGGG - Intergenic
1054281760 9:63133482-63133504 GTGTGTGTGGCAAGTCTGCTGGG + Intergenic
1054295049 9:63326953-63326975 GTGTGTGTGGCAAGTCTGCTGGG - Intergenic
1054393071 9:64631453-64631475 GTGTGTGTGGCAAGTCTGCTGGG - Intergenic
1054427720 9:65136663-65136685 GTGTGTGTGGCAAGTCTGCTGGG - Intergenic
1054502656 9:65884875-65884897 GTGTGTGTGGCAAGTCTGCTGGG + Intronic
1055025441 9:71714845-71714867 GTTTCTGTGATAATCCTGGATGG - Intronic
1055415559 9:76079074-76079096 GTGTGTGTGGCTAGTGTGGATGG + Intronic
1056641958 9:88379061-88379083 TTGTTTGAGAGAAGCCTGGAAGG + Intergenic
1057528758 9:95825491-95825513 CTGAGTGTGATAAACCTGGACGG - Intergenic
1057911272 9:99022160-99022182 GTGTGTGTGACAAGCCTGGATGG - Intronic
1059658492 9:116378266-116378288 GTGTCAGTGACAAGCTTGGGAGG + Intronic
1062672725 9:137721154-137721176 GTGAGTGTGAGAAGTCTGGGAGG - Intronic
1062672731 9:137721179-137721201 GTGAGTGTGAGAAGTCTGGGAGG - Intronic
1062672736 9:137721203-137721225 GTGAGTGTGAGAAGTCTGGGAGG - Intronic
1062672747 9:137721252-137721274 GTGAGTGTGAGAAGTCTGGGAGG - Intronic
1062672752 9:137721276-137721298 GTGAGTGTGAGAAGTCTGGGAGG - Intronic
1062672758 9:137721301-137721323 GTGAGTGTGAGAAGTCTGGGAGG - Intronic
1062672763 9:137721325-137721347 GTGAGTGTGAGAAGTCTGGGAGG - Intronic
1185856598 X:3542086-3542108 GTGTGTGAGATAATCGTGGAAGG + Intergenic
1186075649 X:5875298-5875320 GTGTGTCCCACAAGCCTGGAAGG + Intronic
1186756968 X:12681686-12681708 GTGTGTGTGTGTATCCTGGATGG - Intronic
1189546945 X:42051205-42051227 GTGGGTGTGACATGCGTGGATGG - Intergenic
1193391454 X:80933731-80933753 GTGTGTGTGACAATTATGAATGG - Intergenic
1193904306 X:87224291-87224313 GTGTGTGGGACAATGGTGGAAGG + Intergenic
1194691937 X:96997389-96997411 GTGTGTAAGATAAGCTTGGATGG + Intronic
1195026052 X:100878746-100878768 GAGTTTGAGACAAGCCTGGCTGG + Intergenic
1195750236 X:108156998-108157020 GTGTGTATGAAAAGCCTGTAGGG - Exonic
1196641650 X:118069096-118069118 GTGTGTGTGACTCTTCTGGATGG - Intronic
1198825513 X:140694541-140694563 GTTTGTGTGAGATGCCTGGGAGG - Intergenic
1199351808 X:146810469-146810491 GTGTGTGTGAGAAGGCAGGGAGG + Intergenic
1199352099 X:146814024-146814046 GTGTGTGTGAGAAGGCAGGGAGG - Intergenic
1200108141 X:153725591-153725613 GTGTATGTGGCCCGCCTGGACGG + Exonic
1202082073 Y:21093511-21093533 GTGTGTCTGACAATCCTTGTTGG - Intergenic