ID: 1057911878

View in Genome Browser
Species Human (GRCh38)
Location 9:99025906-99025928
Sequence CAACTCCAGGCTGTCCCTCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 290}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057911878_1057911882 -10 Left 1057911878 9:99025906-99025928 CCCTGAGGGACAGCCTGGAGTTG 0: 1
1: 0
2: 0
3: 25
4: 290
Right 1057911882 9:99025919-99025941 CCTGGAGTTGATGGAGCCACCGG 0: 1
1: 0
2: 1
3: 26
4: 359
1057911878_1057911896 23 Left 1057911878 9:99025906-99025928 CCCTGAGGGACAGCCTGGAGTTG 0: 1
1: 0
2: 0
3: 25
4: 290
Right 1057911896 9:99025952-99025974 ATGAAAGGGGAGAAGGTACGGGG 0: 1
1: 0
2: 1
3: 22
4: 269
1057911878_1057911894 21 Left 1057911878 9:99025906-99025928 CCCTGAGGGACAGCCTGGAGTTG 0: 1
1: 0
2: 0
3: 25
4: 290
Right 1057911894 9:99025950-99025972 GGATGAAAGGGGAGAAGGTACGG 0: 1
1: 0
2: 10
3: 86
4: 1078
1057911878_1057911883 -1 Left 1057911878 9:99025906-99025928 CCCTGAGGGACAGCCTGGAGTTG 0: 1
1: 0
2: 0
3: 25
4: 290
Right 1057911883 9:99025928-99025950 GATGGAGCCACCGGCCTTCCCGG 0: 1
1: 0
2: 1
3: 16
4: 180
1057911878_1057911888 9 Left 1057911878 9:99025906-99025928 CCCTGAGGGACAGCCTGGAGTTG 0: 1
1: 0
2: 0
3: 25
4: 290
Right 1057911888 9:99025938-99025960 CCGGCCTTCCCGGGATGAAAGGG 0: 1
1: 0
2: 0
3: 5
4: 57
1057911878_1057911889 10 Left 1057911878 9:99025906-99025928 CCCTGAGGGACAGCCTGGAGTTG 0: 1
1: 0
2: 0
3: 25
4: 290
Right 1057911889 9:99025939-99025961 CGGCCTTCCCGGGATGAAAGGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1057911878_1057911886 8 Left 1057911878 9:99025906-99025928 CCCTGAGGGACAGCCTGGAGTTG 0: 1
1: 0
2: 0
3: 25
4: 290
Right 1057911886 9:99025937-99025959 ACCGGCCTTCCCGGGATGAAAGG 0: 1
1: 0
2: 0
3: 2
4: 48
1057911878_1057911884 0 Left 1057911878 9:99025906-99025928 CCCTGAGGGACAGCCTGGAGTTG 0: 1
1: 0
2: 0
3: 25
4: 290
Right 1057911884 9:99025929-99025951 ATGGAGCCACCGGCCTTCCCGGG 0: 1
1: 0
2: 1
3: 23
4: 160
1057911878_1057911895 22 Left 1057911878 9:99025906-99025928 CCCTGAGGGACAGCCTGGAGTTG 0: 1
1: 0
2: 0
3: 25
4: 290
Right 1057911895 9:99025951-99025973 GATGAAAGGGGAGAAGGTACGGG 0: 1
1: 0
2: 1
3: 48
4: 388
1057911878_1057911891 16 Left 1057911878 9:99025906-99025928 CCCTGAGGGACAGCCTGGAGTTG 0: 1
1: 0
2: 0
3: 25
4: 290
Right 1057911891 9:99025945-99025967 TCCCGGGATGAAAGGGGAGAAGG 0: 1
1: 0
2: 1
3: 26
4: 250
1057911878_1057911897 30 Left 1057911878 9:99025906-99025928 CCCTGAGGGACAGCCTGGAGTTG 0: 1
1: 0
2: 0
3: 25
4: 290
Right 1057911897 9:99025959-99025981 GGGAGAAGGTACGGGGAACACGG 0: 1
1: 0
2: 0
3: 21
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057911878 Original CRISPR CAACTCCAGGCTGTCCCTCA GGG (reversed) Exonic
900177274 1:1296396-1296418 CACCCCCAGCCTGGCCCTCAGGG + Intronic
900432685 1:2610503-2610525 CAGCTCCTGGCTGTCCGCCAGGG + Intronic
901723980 1:11225620-11225642 CAACTCCAGCCTGGCCAACATGG - Intronic
902248832 1:15140108-15140130 AAAATCCAGGCTGGCCCTCAAGG + Intergenic
902340496 1:15780398-15780420 CAACACCAGGCTGGCCAACATGG - Intronic
902983968 1:20144183-20144205 CCACCCCTGGCTGTGCCTCATGG - Intronic
903024610 1:20418468-20418490 CAGCTCCAGGATGCACCTCAGGG - Intergenic
904159978 1:28515980-28516002 CAAGTCCAGGCTGGCCAACATGG + Intronic
904456091 1:30649139-30649161 CAGCTCCAGGCTGGGCATCAGGG + Intergenic
904508742 1:30983206-30983228 CCACTCCTGGCTGCCCCTCTTGG - Intronic
905231250 1:36516078-36516100 CAAGTCCAGGCTCTTCCTCCGGG + Intergenic
906535104 1:46547187-46547209 AAACTCCTGGCAGTTCCTCAGGG - Intronic
907457207 1:54583307-54583329 CAAATCCTGGCTGTACCACATGG + Intronic
907588894 1:55646873-55646895 CCAATCCAGGCTGCCCCTCCTGG - Intergenic
908351063 1:63286589-63286611 CAATGCCAGGCTGACCCCCATGG + Intergenic
908695839 1:66840813-66840835 CAGGTCCAGGCTGCCCTTCATGG - Intronic
909582573 1:77254231-77254253 CAACTCCAGGCAGCCCAGCATGG + Intergenic
909665389 1:78126713-78126735 CAGCTTCAGTCTCTCCCTCATGG + Intronic
910459351 1:87432178-87432200 CAACTCCAGGTAGTTCCTCAGGG - Intergenic
912392819 1:109316431-109316453 CAAGACCAGGCTGTCCAACATGG - Intronic
913222355 1:116669177-116669199 CAACACCAGGCTGCCCAACATGG - Intergenic
914316584 1:146518521-146518543 CAACTCCAGGTAGTTCCTCAGGG - Intergenic
914497772 1:148214840-148214862 CAACTCCAGGTAGTTCCTCAGGG + Intergenic
916126830 1:161579011-161579033 CAAGACCAGGCTGTCCAACATGG + Intergenic
916136749 1:161660851-161660873 CAAGACCAGGCTGTCCAACATGG + Intronic
917092398 1:171366532-171366554 CAACCCCAGCCTGGCCATCATGG - Intergenic
918697297 1:187560333-187560355 CAACTCCAGCCAGGGCCTCAGGG - Intergenic
920262498 1:204698767-204698789 CAACTTCATGCTGTCTCTCTTGG + Intergenic
920384340 1:205557917-205557939 CAACTCCATGATGCTCCTCATGG + Intergenic
920909746 1:210205282-210205304 CAAGACCAGGCTGGCCATCATGG - Intergenic
920935729 1:210432692-210432714 CATTTCCAGGCTGCTCCTCAGGG + Intronic
921147001 1:212367668-212367690 CAACTCCAGGCAGTGCAGCATGG + Intronic
921897335 1:220414268-220414290 CAAGTCCAGCCTGTCCAACATGG - Intergenic
922008973 1:221562184-221562206 CATCTCCAGGCTTACTCTCAAGG - Intergenic
922499558 1:226086454-226086476 CCGCTCCAGGGTGTCCCTGAAGG - Intergenic
923030355 1:230244516-230244538 CTCCGCCAGGCTGTCTCTCAGGG + Intronic
923259236 1:232251084-232251106 CAACATCAGGCTGTGCCCCATGG + Intergenic
923429888 1:233909798-233909820 CAACTAAAGGCTGCCCCCCATGG - Intronic
923837306 1:237626772-237626794 CAACACCAGCCTGGCCATCATGG - Intronic
1064468374 10:15609040-15609062 CAACTCCAAAGTGTCTCTCATGG - Intronic
1064645044 10:17452581-17452603 CAACTCCTGTCTGTCCATCTTGG + Intronic
1065705540 10:28468861-28468883 CAGCTACAGCCTGTGCCTCATGG + Intergenic
1066198575 10:33125280-33125302 CATCCCCTGGCTGTCCCTGATGG + Intergenic
1066275808 10:33867337-33867359 GACCTCCAGGCTGTTCCACAGGG + Intergenic
1067799719 10:49350684-49350706 CTCCTCCATGCTGTCCCTGAGGG - Intergenic
1068673881 10:59750269-59750291 CAACACCAGCCTGTCCAACATGG - Intergenic
1069615813 10:69805449-69805471 CAACCCTAGGGTGTCCCTCCAGG - Intronic
1070468694 10:76754427-76754449 CAACACCATGCTGTCTCTAATGG - Intergenic
1071319952 10:84444607-84444629 CTTCTCCCTGCTGTCCCTCAAGG - Intronic
1071395761 10:85222258-85222280 CTAATCCAGGCTGTAACTCAGGG + Intergenic
1071767886 10:88689495-88689517 CAACTCCAGGCTCTGACTCCTGG + Intergenic
1072347472 10:94522711-94522733 CAAGACCAGCCTGTCCCACATGG + Intronic
1074104336 10:110377097-110377119 CCATTCCTGGCTGTCCCTCTTGG + Intergenic
1075214459 10:120520043-120520065 CAGCTCCAGGCTCTGCCTCAGGG + Intronic
1075731328 10:124638481-124638503 CAACTCCATGCAGCCCCTCTAGG - Intronic
1075864612 10:125706833-125706855 CCACTCCAGGCTCTGCCTCTTGG + Intergenic
1077097172 11:803980-804002 CAGCTCCAGGCCGCCCCTCCCGG - Intronic
1078548596 11:12264434-12264456 CAACTCCAGGCTGTGTTTAAGGG + Intergenic
1078860221 11:15239905-15239927 CTGCCCCAGGCTGTCCCTCTGGG - Intronic
1079076091 11:17386370-17386392 CAGCCCCAGGCTGTCCCTGCCGG + Exonic
1079121049 11:17685292-17685314 GAGCTCCAGGCTGCCCCTAAGGG + Intergenic
1080187331 11:29505497-29505519 CATCTCTATGCTGTTCCTCATGG - Intergenic
1081927367 11:46842146-46842168 AACCTCAAAGCTGTCCCTCAAGG + Intronic
1083340330 11:61955098-61955120 CACCCCCAGGCTGGCCCTCACGG + Exonic
1083716087 11:64577873-64577895 GGACTCAAGCCTGTCCCTCATGG - Intergenic
1085862526 11:80251269-80251291 CGTTTCCAGACTGTCCCTCAAGG - Intergenic
1088716991 11:112557280-112557302 CAGGTCCAGGCTGGCTCTCAGGG - Intergenic
1092003062 12:5047041-5047063 CTACTCCAGGCTGACCATAAGGG - Intergenic
1093559478 12:20521109-20521131 AAACTCCTGGCTGTCTCTCCTGG + Intronic
1097184048 12:57187184-57187206 CTGCCCCAGGCTGTCCCCCACGG + Intronic
1097844655 12:64353879-64353901 CAAGACCAGCCTGTCCCACATGG - Intronic
1099133639 12:78865304-78865326 CAACTCCAGGCTCTAAATCACGG - Intronic
1100178814 12:92061258-92061280 TAACACCAAGATGTCCCTCAGGG - Intronic
1100257211 12:92896600-92896622 CAACTCCAGCCTGACCAACATGG + Intronic
1100988171 12:100224727-100224749 CAACACCAGGCTGGCCAACAAGG - Intronic
1101607555 12:106259049-106259071 CAACTCCAGGCTCTGGCTCCTGG + Intronic
1103541140 12:121667453-121667475 CAACACCAGGCTGGCCAACATGG - Intronic
1103617355 12:122162763-122162785 CAACACCAGGCTGGCCAACATGG - Intergenic
1103959191 12:124597477-124597499 CAACCCCAGCCAGACCCTCAGGG + Intergenic
1105466613 13:20648193-20648215 CAAGACCAGCCTGTCCATCATGG + Intronic
1110563356 13:76933531-76933553 CAACACCAGCCTGGCCATCATGG + Intergenic
1112578715 13:100660128-100660150 CGACACCAGCCTGTCCATCATGG + Intronic
1117185806 14:53239474-53239496 CTACTCCAGGCAGTCATTCAGGG - Intergenic
1118721789 14:68599695-68599717 CAACACCAGCATGTCACTCATGG - Intronic
1119747205 14:77052865-77052887 CAGCTCCATGCTGTGCCACAGGG - Intergenic
1120155083 14:81084606-81084628 CACCTTCAGGCAGTCACTCAGGG + Intronic
1120989312 14:90361272-90361294 CAACACCAGCCTGGCCATCATGG - Intergenic
1121344260 14:93123611-93123633 CAAGACCAGCCTGTCCCACATGG - Intergenic
1122306208 14:100768384-100768406 CGATTCCAGGCTGTCTCCCATGG + Intergenic
1122865542 14:104602376-104602398 CACCTCCTGGGTGTCCCTCAGGG - Intronic
1124410672 15:29433715-29433737 CTGCTACTGGCTGTCCCTCAAGG + Intronic
1124652371 15:31483483-31483505 GAACTCCAGGCCGTCGCGCAGGG + Exonic
1126869259 15:52970269-52970291 CCACACTAGTCTGTCCCTCAAGG + Intergenic
1127976086 15:63998351-63998373 CAGGTCCAGGCTTTCCCTCTGGG + Intronic
1128802376 15:70504987-70505009 CAGCTCCAGAATGTTCCTCAGGG + Intergenic
1129742495 15:77996249-77996271 CAACACGAGCCTGTCCCTAAAGG + Exonic
1129842988 15:78755228-78755250 CAACACGAGCCTGTCCCTAAAGG - Intergenic
1131321692 15:91399880-91399902 CAATGCCAGGCTGGCCCTCATGG - Intergenic
1131423624 15:92327621-92327643 CAAATCCTAGCTGTCCTTCAAGG + Intergenic
1132135300 15:99331792-99331814 CACCTCCATGCTTTTCCTCATGG + Intronic
1132411002 15:101578250-101578272 CCTCTCCAGGCTGTCCTCCATGG + Intergenic
1132852383 16:2030541-2030563 CAGCTTCAGGCTGTTCCTCCTGG - Intronic
1132982356 16:2745008-2745030 CAACCCCAGGCTGACCCACTGGG + Intergenic
1134604496 16:15559708-15559730 CGACCCCAAGCTGTCCATCAGGG - Intronic
1134658898 16:15969005-15969027 CAAGGCCAGGCTGTCCAACATGG + Intronic
1136068969 16:27776791-27776813 GAACTCCAGGCTGGCCCACGTGG + Intronic
1136243971 16:28962719-28962741 CAACATCACGCAGTCCCTCAGGG + Intronic
1137722609 16:50636255-50636277 CAACTCCGGGCTGGCCTCCAGGG - Exonic
1138269625 16:55685843-55685865 CAACTCCGGACTGGCCCTCATGG - Intronic
1138524532 16:57594774-57594796 CCATTCCAGGCTTTCCCACATGG - Intergenic
1139068594 16:63351248-63351270 CCACTCCAGGCTATCCCTCTAGG - Intergenic
1139112197 16:63904910-63904932 AGGCTCCAGGCTGGCCCTCAGGG - Intergenic
1139551121 16:67673684-67673706 CTACTGCATGCTGACCCTCAGGG - Intergenic
1139578974 16:67860625-67860647 CCTTTCCAGGCTGTGCCTCAAGG + Intronic
1142002208 16:87670401-87670423 CAAGTCCAGGCTGGACCACAGGG - Intronic
1142380085 16:89726976-89726998 CAAGTCCAGGCTGTCCTAGAAGG + Intronic
1143776293 17:9201374-9201396 CCACTCCATGCTCTTCCTCATGG - Intronic
1144857606 17:18278252-18278274 CAGGTCCAGGATCTCCCTCAGGG + Exonic
1145797649 17:27665169-27665191 CAACTCAAGACTGTCTCTCCAGG - Intergenic
1147628139 17:41913189-41913211 CTATTCCAGGCTGACCCTCCAGG + Intronic
1148106903 17:45123803-45123825 CAGCTCCAGAGGGTCCCTCAGGG + Intronic
1148165862 17:45483568-45483590 CAACTCCTGGCTGAGCATCAGGG + Intronic
1148190562 17:45675879-45675901 CTGCTCCAGGCAGTCACTCAGGG + Intergenic
1150286483 17:63957222-63957244 CACCTCCATGCAGTCCCACATGG + Exonic
1150397085 17:64830282-64830304 CAACTCCTGGCTGAGCATCAGGG + Intergenic
1151193089 17:72412889-72412911 CACCCCCAGGCTGTGCCTCTTGG - Intergenic
1151273708 17:73016789-73016811 CAACTGAAGGCTGACCCTCATGG - Intronic
1152229638 17:79108027-79108049 CAATTCCATGCTGCCCCTTAGGG + Intronic
1152717295 17:81906234-81906256 CCCCTCCCGGCTGTCCCTCATGG + Intronic
1156111180 18:33729352-33729374 CATCTCCAGGCTGTACCTGCAGG + Intronic
1157063572 18:44321269-44321291 CAACTCCAGGCTGAGACTGAGGG - Intergenic
1157604242 18:48915674-48915696 CAACTCCTGATTGTCCCTGAGGG - Intergenic
1157718986 18:49908990-49909012 CAGCCCCAGGCTGCCCCTCCAGG + Intronic
1159105549 18:63999424-63999446 CAACTCAATGCTGTTCCACATGG + Intronic
1160475887 18:79187355-79187377 CACCTCCACACTGTCCCACAGGG + Intronic
1160676144 19:392425-392447 CACCTCCAGGCTTTTCCTCCTGG - Intergenic
1160811108 19:1013266-1013288 GAACTCCTGGCTGTCATTCAGGG + Exonic
1161061173 19:2215751-2215773 CTACTCCAGGCAGACCCACAGGG - Intronic
1162847155 19:13401760-13401782 CGACTCCATGCAGTCACTCAGGG - Intronic
1162907916 19:13834305-13834327 CCACTCTAGGGTTTCCCTCATGG + Intergenic
1163718237 19:18884914-18884936 CAAGTCCAGTCTGTCCAACATGG - Intronic
1163961453 19:20698766-20698788 CAAGACCAGGCTGGCCATCATGG + Intronic
1164138935 19:22440203-22440225 CAAGACCAGGCTGGCCCACATGG - Intronic
1164515180 19:28928200-28928222 CAACTCCAGCCTCCCCCTCCAGG - Intergenic
1165110414 19:33498915-33498937 CCACCCCAGGCTGCCCCTCCAGG + Intronic
1165773392 19:38390735-38390757 CAACCCCAGGCTGTTCCACAGGG + Intronic
1166828721 19:45625606-45625628 CACCTCCAGTCTGTCTCTCTAGG + Intronic
1167749335 19:51370509-51370531 CTGCTCCTGGCTGCCCCTCAGGG + Intergenic
1167775201 19:51550121-51550143 CAACCCCAGGCTGACACTCTGGG - Intergenic
1167947084 19:52996871-52996893 CAACACCAGCCTGGCCATCATGG + Intergenic
1168132305 19:54329309-54329331 CAACACCAGGCTGGCCAACATGG + Intergenic
926615921 2:14996454-14996476 CAGCACCAAGCTGTCCGTCAAGG + Intergenic
928032892 2:27796763-27796785 CAGCTCCAGGCGCTGCCTCAGGG - Intronic
929670820 2:43875512-43875534 CAACTCGAGGCTGGCCCTTCTGG + Intronic
929871622 2:45763786-45763808 CAGCTCTAGGCTCTCTCTCACGG + Intronic
930019901 2:46995202-46995224 AAGCTCCAGGATGTCCTTCAGGG + Intronic
931149803 2:59560467-59560489 CAAGTCCAGCCTGTCCAACACGG + Intergenic
932685058 2:73861935-73861957 CAAGTCCAGGCTGACCAACATGG + Intronic
938421464 2:131150674-131150696 CTGCTCCAGGCTGTCATTCAGGG + Intronic
940461374 2:153967603-153967625 CAACTCCAGGCAGTGCCACATGG - Intronic
941312860 2:163955727-163955749 CTCCTCCAGACTGCCCCTCAAGG - Intergenic
943165541 2:184319923-184319945 CATCACCAGGTTGTCTCTCACGG - Intergenic
943250723 2:185518604-185518626 CAACTCCAGCCAGGGCCTCAGGG - Intergenic
946143386 2:217710894-217710916 CAACTACAGGCTGTAACACAAGG + Intronic
948109696 2:235444864-235444886 CATCCCCAGGCTGACACTCAGGG - Intergenic
948319711 2:237059718-237059740 CAGCCCCAAGCTGTCCCTGAGGG + Intergenic
948430100 2:237913361-237913383 CAACGACAGGCTCTCCCTCAAGG - Intergenic
948558389 2:238834057-238834079 CTGCTCCAGGCTTTCCCTCCAGG - Intergenic
948561253 2:238854754-238854776 ATGCTCCAAGCTGTCCCTCATGG - Intronic
948752345 2:240139891-240139913 CAGCTCCAAGCTGGCTCTCAAGG + Intronic
1168933504 20:1644250-1644272 CAACTCCAGCCTGGGGCTCAGGG - Intronic
1169201183 20:3710977-3710999 CAACTCCAGGCTTTCAAACAGGG - Intergenic
1169422598 20:5471961-5471983 CAACTCCAGGAACTCCATCAAGG + Intergenic
1169426872 20:5503821-5503843 CAACTCCAGGAACTCCATCAAGG - Intergenic
1171212261 20:23326102-23326124 CAAATGCAGGCTGTCTATCAAGG + Intergenic
1171412530 20:24956780-24956802 CAACCCCAGCCTGGCCCTCTGGG - Intronic
1172390667 20:34562794-34562816 CAGCTCCAGGCTGGCCCACTGGG + Intronic
1173084637 20:39904085-39904107 CAATCACAGGCTGTCTCTCACGG - Intergenic
1173940942 20:46910623-46910645 GAAATCCAGGCTGACCATCAGGG - Intronic
1173965769 20:47111523-47111545 CAAGTCCAGGCTTTTCCTCGTGG + Intronic
1174807964 20:53620986-53621008 CAAGACCAGCCTGGCCCTCATGG - Intergenic
1175872628 20:62215742-62215764 GACCTCCAGACTGTCCCTCCCGG + Exonic
1177405075 21:20656383-20656405 CAACACCATCCTGTCCCACATGG - Intergenic
1178676493 21:34635630-34635652 CACTTCCAGCCTGTCCCCCAGGG + Intergenic
1178960464 21:37060086-37060108 CAACTCCATGCAGTCACTCTTGG - Intronic
1179907517 21:44431676-44431698 CAAGACCAGGCTGACCATCATGG - Intronic
1180669592 22:17542776-17542798 CATCTCTGGGCTGTCCATCATGG - Exonic
1180967376 22:19797722-19797744 CAACACCAGCTTGTCTCTCAAGG + Intronic
1182258936 22:29058898-29058920 CAGCTCCAGGCTGTACCTCTTGG + Exonic
1183208489 22:36435266-36435288 CAACACCAGGCTGACCAACATGG + Intergenic
1183951911 22:41357111-41357133 CCACCCCAGGCTGTCCATCTGGG - Intronic
1184096707 22:42319976-42319998 CTACTCCAGGCTCTACCCCAAGG + Intronic
949187208 3:1206455-1206477 CACCACCAGGGTGTCACTCAAGG + Intronic
950206332 3:11084096-11084118 CAACTCCAGGCTCTCCTTGGTGG - Intergenic
950282983 3:11722766-11722788 CAAGTCCAGGCTGGCCAACATGG + Intergenic
951574664 3:24101399-24101421 CGACTCCAGGCTGTCCCCCTTGG + Intergenic
952960388 3:38585751-38585773 CACCTCCATGCAGTCCCACATGG + Exonic
955339799 3:58116522-58116544 CACCTGCAAGCTGTCACTCAGGG - Intronic
958187631 3:90143368-90143390 CAACTCCATGCTTTCAGTCAGGG + Intergenic
958762284 3:98323551-98323573 GAAGTCTAGGCTGTCCCACAGGG - Intergenic
959061270 3:101618608-101618630 CAAGACCAGGCTGGCCATCATGG + Intergenic
959289074 3:104449634-104449656 CAGCTCTAGGCTGGCCCTCAGGG + Intergenic
961270449 3:125683801-125683823 CCAGCCCAGGCTGTCCCCCAAGG - Intergenic
961458860 3:127037756-127037778 CTCCCCCAGGCTGTCGCTCATGG - Intergenic
962988351 3:140556602-140556624 CAACTCCAGGCAGTTCCCAACGG + Exonic
963255796 3:143143671-143143693 TAACTCCATGATATCCCTCAGGG - Intergenic
965801778 3:172501705-172501727 CCACTACATGCTGTCTCTCAGGG - Intergenic
965854055 3:173066440-173066462 CAACTCCAGGCAGCCCAGCATGG + Intronic
966242958 3:177774993-177775015 CACCTCTAGCCTGGCCCTCAGGG - Intergenic
966503303 3:180671009-180671031 CAAGACCAGCCTGTCCCACATGG + Intronic
968218586 3:196915684-196915706 CAACTCCAGGCAGCCCATCATGG + Intronic
968487068 4:867869-867891 CACCTCCAGCCTCTGCCTCAAGG + Intronic
969348759 4:6585771-6585793 CTACTCCAGGCTGGCTCTCGCGG + Intronic
970108929 4:12616293-12616315 CAGCTCCAGTGTGTCCTTCAGGG - Intergenic
971697398 4:29924368-29924390 CAAGGCCAGGCTGGCCCACATGG - Intergenic
972090565 4:35276371-35276393 CTTTTCTAGGCTGTCCCTCATGG - Intergenic
972557400 4:40194766-40194788 CAACTCCAGGGTGTGCGGCAGGG - Intronic
974808916 4:66920677-66920699 CAACTCCTTGCTGTGCCTCCTGG + Intergenic
975671648 4:76786789-76786811 CAACACCATGCTGTGCCCCACGG + Intergenic
975794865 4:77996613-77996635 CAAGTCCAGGTTGTCACTCATGG + Intergenic
976213306 4:82692891-82692913 CAGCTTCAGCCTCTCCCTCAGGG - Intronic
976453905 4:85223546-85223568 CAATTCCAGGCTCTAGCTCATGG - Intergenic
976762765 4:88568408-88568430 CAACTCCAGGCCCTGGCTCATGG - Intronic
976862632 4:89684599-89684621 CAAATCCTGGCTGTCCTTCAGGG + Intergenic
976912338 4:90323191-90323213 CAATTCCAGGCTGTGCAGCATGG - Intronic
977892432 4:102327481-102327503 CAACTCCTGTCTGTCCTGCAAGG + Intronic
978128116 4:105159453-105159475 CAACACCAGGCTGACCAACATGG - Intronic
978374143 4:108057550-108057572 CAGCTCCTGGCAGACCCTCAGGG + Intronic
979430985 4:120630592-120630614 CAACTGGAGGCTGCCCCTTATGG + Intergenic
979631772 4:122910489-122910511 CCACTCCAAGCAGTCCTTCAGGG - Intronic
986370225 5:7072860-7072882 CCTCTCCATGCTCTCCCTCATGG - Intergenic
986556032 5:9010419-9010441 CAACTCCTGCCACTCCCTCAGGG + Intergenic
987104939 5:14629291-14629313 CAATTCCAGACTGACCCACATGG - Intergenic
988160149 5:27508894-27508916 CAACTCCAGCCTGGCCAACATGG - Intergenic
988800393 5:34691113-34691135 CAACTCCTACCTATCCCTCAAGG - Intronic
989751179 5:44895716-44895738 CAACTCCAGGCAGTGCCACTTGG - Intergenic
992768703 5:80027380-80027402 CAATTCCTGGATTTCCCTCATGG - Intronic
994601048 5:101905678-101905700 CAACCCCATGCTGTTCTTCAAGG - Intergenic
995691527 5:114831091-114831113 CAACTCAGGGGTGTCCCTGAAGG + Intergenic
996246057 5:121264682-121264704 CAACACCAGCCTGACCATCATGG - Intergenic
997832614 5:137164294-137164316 CAATTCCAGGCTGTAGCTCTTGG + Intronic
998309655 5:141115250-141115272 CAACTCTAGGCTGTCTACCAAGG + Intronic
998818999 5:146041576-146041598 CAACTCCAGATTGTCCCTAGTGG + Intronic
1001655263 5:173344405-173344427 CAAGACCAGGCTGGCCCACATGG - Intergenic
1002197663 5:177509947-177509969 CAACTCCTGGCTTTCCCACTCGG + Intronic
1002779101 6:352863-352885 CATCTCCAGGGTGACCCACAAGG - Intergenic
1003306645 6:4934981-4935003 CAACTCCTGAGTGTCCCACAGGG + Intronic
1004005582 6:11634436-11634458 CAAGTCCAGGCAGGCGCTCAGGG - Intergenic
1004198385 6:13525987-13526009 CAACACCAGCCTGTCCAACATGG + Intergenic
1005754304 6:28911799-28911821 CAACTACAGACTGGCTCTCATGG + Intronic
1006807776 6:36799650-36799672 CAACTCTTGGCTGTGCCTCTGGG - Intronic
1008643103 6:53484832-53484854 CAATTCCAGCATCTCCCTCATGG - Intergenic
1011811190 6:91134089-91134111 CAGCTCCAGGATGTCCCTGCTGG + Intergenic
1012433105 6:99186765-99186787 TAACTCCTGGCTATTCCTCAGGG - Intergenic
1012450404 6:99348925-99348947 CAACTCTAAACTGCCCCTCACGG + Intronic
1013573730 6:111457420-111457442 CAACCCCAGGCTATATCTCATGG + Intronic
1013591937 6:111626190-111626212 CAAGTCAGAGCTGTCCCTCATGG - Intergenic
1014422324 6:121261098-121261120 CAACTCCAGCCAGTGGCTCAGGG + Intronic
1014623787 6:123701340-123701362 CAAGACCAGCCTGTCCCACATGG - Intergenic
1016958917 6:149653071-149653093 CAAGACCAGGCTGTCCAACATGG + Intergenic
1018155271 6:160979823-160979845 CAACTCCAGGAATCCCCTCATGG - Intergenic
1018339654 6:162838274-162838296 CTGCTCCAGGCAGTCACTCAGGG + Intronic
1019037584 6:169074412-169074434 CAATTCCTGTCTGTCACTCATGG + Intergenic
1019055774 6:169222271-169222293 CTACTCCGGCGTGTCCCTCAAGG - Exonic
1021545944 7:21812916-21812938 CAAAACCAGGCTCTCCCCCAAGG - Intronic
1023074040 7:36465535-36465557 CAGCTCCAGCCAGTCCCTCTGGG - Intergenic
1025077696 7:55957256-55957278 CAAGACCAGGCTGTCCAACATGG - Intronic
1026127208 7:67589392-67589414 CAACTCCAAGCTGGTCGTCAAGG + Intergenic
1026808446 7:73442784-73442806 CAGCTCCAGGCTTTGCCTCCGGG + Exonic
1027183480 7:75955588-75955610 CAAATCCAGGGAGTCCCTGAAGG - Intronic
1027624380 7:80528725-80528747 AGACTCCAGGCTGGCACTCATGG + Intronic
1028459204 7:91071978-91072000 CAACTCCAGGCAGGGGCTCAGGG + Intronic
1029293425 7:99519857-99519879 CAGCTCCTGGCTGTCCTTCAGGG - Exonic
1030450989 7:109710790-109710812 CTACTTCAGGCTGTCCCTTGTGG + Intergenic
1031440465 7:121788464-121788486 CAGCTCATGGCTGTCCCTCTTGG - Intergenic
1032080425 7:128855963-128855985 CGCCTCCTGGCTGCCCCTCAGGG + Intronic
1035875172 8:3180842-3180864 CAAGACCAGGCTGTCCAACACGG - Intronic
1036287975 8:7461609-7461631 CACCCCCACCCTGTCCCTCACGG - Intronic
1036333501 8:7849919-7849941 CACCCCCACCCTGTCCCTCACGG + Intronic
1037449157 8:18999257-18999279 CAACTCCAGGATGTCTCACAAGG + Intronic
1039185521 8:34911354-34911376 CACCACCAGGCCATCCCTCATGG + Intergenic
1039267534 8:35841870-35841892 CAGCACCTGGCTGGCCCTCATGG + Intergenic
1042687811 8:71461780-71461802 CACAGCCAGGGTGTCCCTCAGGG + Intronic
1042971067 8:74409551-74409573 CAACACCAGGCTGGCCAACATGG - Intronic
1047290149 8:123522774-123522796 CAAATCCTGGCCGTCCCTCAAGG + Intronic
1048312671 8:133337708-133337730 CAACTCTTGGCTGTACCGCAGGG + Intergenic
1048854385 8:138673965-138673987 CAACGCCATGCAGTCACTCAGGG + Intronic
1049004408 8:139845660-139845682 TGACTCCAGGCTGTGCCCCAGGG + Intronic
1049435220 8:142583382-142583404 CAAAGCCAGGCTGTCCAGCAGGG - Intergenic
1051331715 9:16030829-16030851 CAACTCCTGGCTTTCCATCTGGG + Intronic
1052094032 9:24362766-24362788 CAACTCCAGGCCCTGCCTCCTGG + Intergenic
1052998246 9:34563136-34563158 CAACTCCCGGTTGTCCTCCAAGG + Intronic
1056949633 9:91031776-91031798 CAACACCAGGCTGAGCCGCAGGG - Intergenic
1057298034 9:93860775-93860797 GAAGCCCAGGCTGTCCCTCTTGG + Intergenic
1057911878 9:99025906-99025928 CAACTCCAGGCTGTCCCTCAGGG - Exonic
1057992625 9:99786554-99786576 CAACTGCAGGATTTCCTTCAAGG - Intergenic
1059184986 9:112260107-112260129 CAACTCCAGCCTGGCCAACATGG - Intronic
1059346747 9:113634249-113634271 CAAGTGCAGACTGTTCCTCATGG - Intergenic
1059433005 9:114260970-114260992 CAAATCCAGGCTCTTCCTCTTGG + Intronic
1061043231 9:128151420-128151442 TGACACCAGGCTGTCCCTCCTGG - Intronic
1061252474 9:129434646-129434668 CATCTCCCAGCTGTCCATCATGG + Intergenic
1061715623 9:132517097-132517119 CCACTTCTGGGTGTCCCTCATGG + Intronic
1062717312 9:138017751-138017773 AAACTCCAGGGTGGCCCTCCAGG + Intronic
1186060926 X:5706204-5706226 CTACTCCAGATCGTCCCTCAAGG - Intergenic
1186690873 X:11974238-11974260 CAGCACCAAGCTCTCCCTCATGG - Intergenic
1187579364 X:20592000-20592022 CCATTCCAGGCTTTCACTCATGG - Intergenic
1190724672 X:53181016-53181038 CAACACCAGTCTGGCCCACATGG - Intergenic
1193213919 X:78840142-78840164 CAATTCCAGGCTGTGGCTCCCGG + Intergenic
1195367399 X:104139315-104139337 CAACACCAGCCTGTCCAACATGG + Intronic
1200048754 X:153417224-153417246 CAACTTCCTGCTGTCCCTCCAGG + Intergenic
1200119073 X:153781933-153781955 CAGCTGGAGGCTGCCCCTCAGGG - Intronic
1200329691 X:155282862-155282884 CAGCTCCAGGCTGGCCCCCATGG + Intronic
1200688152 Y:6276404-6276426 CAACTCCAGGCTGGGCCTGCTGG + Intergenic
1201047115 Y:9898297-9898319 CAACTCCAGGCTGGGCCTGCTGG - Intergenic
1201302868 Y:12525325-12525347 CAACACCAGGCTGGCCAACATGG - Intergenic
1201600256 Y:15720560-15720582 CAAGACCAGCCTGTCCCACATGG + Intergenic