ID: 1057912507

View in Genome Browser
Species Human (GRCh38)
Location 9:99031100-99031122
Sequence CTGTGGCAAAGGAGCCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 319}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057912507_1057912516 22 Left 1057912507 9:99031100-99031122 CCCTGCTGGCTCCTTTGCCACAG 0: 1
1: 0
2: 0
3: 39
4: 319
Right 1057912516 9:99031145-99031167 TGCCCCTGGAGACCTTATGGAGG No data
1057912507_1057912515 19 Left 1057912507 9:99031100-99031122 CCCTGCTGGCTCCTTTGCCACAG 0: 1
1: 0
2: 0
3: 39
4: 319
Right 1057912515 9:99031142-99031164 AGCTGCCCCTGGAGACCTTATGG No data
1057912507_1057912513 8 Left 1057912507 9:99031100-99031122 CCCTGCTGGCTCCTTTGCCACAG 0: 1
1: 0
2: 0
3: 39
4: 319
Right 1057912513 9:99031131-99031153 ACTTTCCATGAAGCTGCCCCTGG No data
1057912507_1057912517 23 Left 1057912507 9:99031100-99031122 CCCTGCTGGCTCCTTTGCCACAG 0: 1
1: 0
2: 0
3: 39
4: 319
Right 1057912517 9:99031146-99031168 GCCCCTGGAGACCTTATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057912507 Original CRISPR CTGTGGCAAAGGAGCCAGCA GGG (reversed) Intronic
900687113 1:3955630-3955652 CTGTGGGAAAGGAGCCAATAAGG - Intergenic
901690019 1:10966756-10966778 CTGGGGCAAAGGAGGAAGCCGGG - Intronic
902360810 1:15941708-15941730 TTGGGGCAAAGCAGCCAGCCTGG + Intergenic
902474212 1:16672685-16672707 CTGTGCCAAGAGACCCAGCAAGG + Intergenic
902484591 1:16734757-16734779 CTGTGCCAAGAGACCCAGCAAGG - Intergenic
902495470 1:16869164-16869186 CTGTGCCAAGAGACCCAGCAAGG - Intronic
902568575 1:17332000-17332022 CTGAGGTCAAGGTGCCAGCAGGG + Intronic
903279783 1:22243948-22243970 CTGTGCCCCAGGAGCCAGCGAGG - Intergenic
903298885 1:22363880-22363902 CTGTGGACAAGGAGCCAACTGGG + Intergenic
904083274 1:27885503-27885525 CAGAGGCAAAGGAAGCAGCAAGG - Intronic
904445590 1:30570929-30570951 ACGTGGCTAAGGAGGCAGCAGGG - Intergenic
904446125 1:30574252-30574274 CTGGGCCAAAGGAGGCAGGAAGG - Intergenic
905852433 1:41283924-41283946 CAGTGGCTCAGGAGCCAGCTCGG - Intergenic
906707951 1:47908691-47908713 CAATGGCCAAGGAGCCAGCTCGG + Intronic
906937826 1:50229770-50229792 CTGCAGCAAAGGAGACAGAAAGG + Intergenic
907306541 1:53516327-53516349 CTGGGCCAAAGGGGCCAGCCTGG - Intronic
909092156 1:71239595-71239617 ATGTGGGAAAGGAACAAGCAGGG - Intergenic
909664935 1:78122066-78122088 CTGTGGCAAAGGTGCCTGAATGG + Intronic
910092420 1:83480792-83480814 CTGAGGCAAAGGAGCATTCAGGG - Intergenic
910251069 1:85200471-85200493 CAGTGGCAAAGGAGACCGCCAGG - Exonic
911278658 1:95895949-95895971 ATGTGGTAAAGAAGCCAGCCAGG - Intergenic
912471026 1:109906984-109907006 GGGTGGTAAAGCAGCCAGCAGGG - Intergenic
913111342 1:115659995-115660017 GTGTGGAAAAGTAGCCAGCAAGG + Intronic
913661943 1:121012390-121012412 CTGTGCCAAGAGACCCAGCAAGG + Intergenic
914013320 1:143795575-143795597 CTGTGCCAAGAGACCCAGCAAGG + Intergenic
914164505 1:145165610-145165632 CTGTGCCAAGAGACCCAGCAAGG - Intergenic
914651942 1:149704184-149704206 CTGTGCCAAGAGACCCAGCAAGG + Exonic
915653131 1:157334276-157334298 CTGCAGCAAAGGAGTGAGCAGGG - Intergenic
915684431 1:157617213-157617235 CTGTAGCAAAGGAGTGAGCAGGG + Intergenic
917830274 1:178875784-178875806 CTCTGGGGAAGGAGCCAGTAGGG + Intronic
918162660 1:181915668-181915690 CTGAAACAAAGGTGCCAGCACGG + Intergenic
918231112 1:182532973-182532995 CTCTGCTTAAGGAGCCAGCAAGG + Intronic
919838197 1:201591111-201591133 CTGTCCCAAAGGAGGCAACACGG + Intergenic
922009050 1:221563217-221563239 CTAAGGCATAGGACCCAGCAAGG + Intergenic
922073107 1:222215855-222215877 CTGTGCCAAAAGAGCCCCCATGG + Intergenic
923025386 1:230199778-230199800 CTGTGTCAAAGGAGGCGGCAGGG + Intronic
924661008 1:246016701-246016723 CTGTGGAAGAGGGGCCAGGAGGG + Intronic
924710433 1:246526618-246526640 ATGGGGCAAAGGAGGGAGCATGG + Intergenic
924739515 1:246786709-246786731 GTGTGGCACAGCAGCCATCAGGG + Intergenic
924947137 1:248854153-248854175 CTGGGGCACAGGGGCCAGGAAGG - Intronic
1063514219 10:6678384-6678406 GTGTGGTAATGGAGCCAGAAGGG - Intergenic
1064384243 10:14877099-14877121 CTGAGGAAAAGGAGCCAAAAAGG + Intergenic
1067026715 10:42848500-42848522 CTGTGGCAGAGTAGCATGCACGG + Intergenic
1067342598 10:45417815-45417837 GTGTGGCAAAGGAAACAGCTAGG - Intronic
1067431208 10:46247304-46247326 TTGTGGCAGAGGAGCTAGAAGGG + Intergenic
1068204421 10:53830773-53830795 CTCTGGCAAAGCACCCAGGAAGG + Intronic
1068715927 10:60188270-60188292 CTGTGCCTCAGGAGCCATCAGGG + Intronic
1068950831 10:62775467-62775489 CTGAGGCTGAGGAGGCAGCATGG - Intergenic
1068960464 10:62862044-62862066 CAGTTGCAAAGATGCCAGCAGGG - Intronic
1069465127 10:68631611-68631633 CTGTGGGGAAAGAGCCAGCAGGG + Intronic
1069838163 10:71322417-71322439 CTGTGGCAATGTACCCAGAAAGG - Intronic
1069979917 10:72245266-72245288 CTGTGGCCACAGAGTCAGCAGGG - Intergenic
1070321947 10:75361004-75361026 CTGTGGTGCAGGAGACAGCAGGG + Intergenic
1070763005 10:79036683-79036705 CTGTGGCCATGGTGCCAGAAGGG - Intergenic
1070969498 10:80551904-80551926 CTGAGGTCAGGGAGCCAGCATGG + Intronic
1071306401 10:84302826-84302848 CTGGGGGAGAGGAGGCAGCATGG - Intergenic
1071491664 10:86140532-86140554 CTGTGTGACAGGAGCCATCATGG + Intronic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1072855002 10:98937091-98937113 CTGTGACAATGGAGCCAAGATGG + Intronic
1072987027 10:100149823-100149845 CTGTGGCAGAGGGGCAAGGAGGG - Intergenic
1073132115 10:101196313-101196335 CTGTGGCAGAGAAACTAGCAGGG - Intergenic
1074235679 10:111582263-111582285 ATGTGGCAGAGCAGCCTGCATGG + Intergenic
1074349177 10:112717966-112717988 CTGTGGGAAGGGAGCAAGGAAGG - Intronic
1074642374 10:115401363-115401385 CTGTGGAGAAAGAGCCAGTAAGG + Intronic
1074661546 10:115664107-115664129 CACTGGCAAAGGGGCCAGGAAGG - Intronic
1074684075 10:115942425-115942447 AAGTGGCAAATGGGCCAGCAGGG - Intronic
1074778401 10:116783300-116783322 CAGTGGCAGAGGAGCCTGGATGG + Intergenic
1075552542 10:123402627-123402649 CTGAGGCAAAGGAGCCACAAAGG - Intergenic
1075716998 10:124561540-124561562 CAGTGACAATGGAGCCCGCATGG + Intronic
1075733615 10:124651083-124651105 CTGCAGCAAAGGTGGCAGCAAGG + Intronic
1076364077 10:129910910-129910932 CTGGGGCACAGGTGCCAGCAGGG + Intronic
1076715538 10:132362094-132362116 CTCAGGCAAAGTAGCCACCATGG + Intronic
1076783542 10:132737608-132737630 CTGTGGCTGAGGAGCTGGCAGGG - Intronic
1077332094 11:1988266-1988288 CAGTGGGCACGGAGCCAGCAGGG - Intergenic
1078063529 11:8062963-8062985 CTGAGGCACAGGAGAAAGCATGG + Intronic
1078564510 11:12403063-12403085 CTGTGGGGAAGGAGGCAGCGAGG - Intronic
1079881931 11:25939220-25939242 CTGTCCCAAAGGAGACAGAAGGG - Intergenic
1080468522 11:32521783-32521805 CTGTAGGCAAGGGGCCAGCAGGG - Intergenic
1080746265 11:35111329-35111351 CAGAGGGAAAGGAGCCAGCTAGG - Intergenic
1083159393 11:60845467-60845489 CTGTGGCGAGGGGCCCAGCAGGG + Intronic
1083660638 11:64250449-64250471 CTGGGGCAAAGGGGCCTGCAGGG + Intergenic
1083803422 11:65059531-65059553 CTGTCCCAGAGGAGGCAGCAGGG + Intergenic
1084958360 11:72703326-72703348 CTGTGTCCAGGCAGCCAGCAGGG - Intronic
1085386129 11:76159408-76159430 CAGGGGCCAAGGAGCCAGCAGGG + Intergenic
1085392233 11:76188352-76188374 GTGGGGCATGGGAGCCAGCAGGG + Intronic
1085504760 11:77051639-77051661 CTGTGGGAATGGAGCATGCAGGG + Intergenic
1085585638 11:77702179-77702201 CAGTGGCACAGGAGCCTGAAAGG - Exonic
1085712360 11:78841658-78841680 CTGTGGGAAAGGAGCCAGGGGGG - Intronic
1086184955 11:84002417-84002439 CTGTGGGAGAGGAGCCCTCATGG - Intronic
1087199420 11:95330531-95330553 CTGAGGGAAAGCTGCCAGCAGGG - Intergenic
1088706849 11:112471567-112471589 CTGTGGTCAAGGAGGCAGTATGG - Intergenic
1089340596 11:117754766-117754788 CTATGGCCAAAGAGGCAGCACGG - Intronic
1090026367 11:123170824-123170846 CTGTGACCAAGGAGGCAGCAGGG - Intronic
1202815075 11_KI270721v1_random:43442-43464 CAGTGGGCACGGAGCCAGCAGGG - Intergenic
1096420238 12:51450970-51450992 GCGGGGCAAAGGAGCCAGCCAGG + Exonic
1097640445 12:62174401-62174423 CTGAGGAAGAGGAGCCAGCAAGG + Intronic
1097964590 12:65565092-65565114 CTGAGGCAAAGGAGCATACAAGG + Intergenic
1098880308 12:75910441-75910463 CTGTGGAACAGCAGGCAGCAGGG - Intergenic
1100822805 12:98447479-98447501 CTGTGGGACAGGAGCCCCCATGG - Intergenic
1101996289 12:109527629-109527651 CTGTGGCCAAGGAGCAAGGCCGG - Intronic
1102256756 12:111419751-111419773 TTGTAGCTAAGGAACCAGCACGG + Intronic
1104159144 12:126161844-126161866 CTGTGGCCAAGCAGACAGCGTGG - Intergenic
1104700277 12:130897851-130897873 CTGTGACAACGGAGAAAGCATGG - Intergenic
1106670138 13:31896540-31896562 CCCTGGCAGAGGAGGCAGCAAGG + Intergenic
1107995486 13:45855730-45855752 CTCTTGCAAAGGAGCCAACTTGG - Intergenic
1109823451 13:67687448-67687470 CTAAAACAAAGGAGCCAGCAGGG + Intergenic
1110249577 13:73366625-73366647 CTGAGGCACAGGAGCCTCCAGGG - Intergenic
1110843635 13:80170131-80170153 CTGAGACCAAGGTGCCAGCATGG + Intergenic
1111018734 13:82417549-82417571 AAGAGGCAAAGGAGCAAGCAAGG - Intergenic
1112932541 13:104760139-104760161 CAGAGGGATAGGAGCCAGCAAGG + Intergenic
1113070324 13:106414100-106414122 AGGAGGCAAAGGAGCCAGCTAGG - Intergenic
1118391305 14:65298114-65298136 CTGTGGAATAGGAGCCACCAAGG - Intergenic
1119253155 14:73174869-73174891 CTTTGGCAAAAGAGCGAGCTAGG - Intronic
1119730422 14:76947566-76947588 CTTTGGCAAAGGCTGCAGCAGGG - Intergenic
1120071581 14:80109215-80109237 CTGGGGCAAAGTACCCAGCAGGG + Intergenic
1120393267 14:83935408-83935430 TTGTGGAAAAGGAACCAGAAAGG + Intergenic
1120921279 14:89757654-89757676 CTGTGGTCAAGGTGTCAGCAGGG - Intergenic
1121400689 14:93674410-93674432 CTGTGCCAGAGGAATCAGCAGGG + Intronic
1121434438 14:93909888-93909910 CTGTGGCAATGGGCCCAGAATGG - Intergenic
1122026852 14:98884326-98884348 CTGAGGCCATGGAGCCAGCATGG - Intergenic
1122738965 14:103859836-103859858 CACTGGCAAGGGAGCGAGCAGGG - Intergenic
1122774289 14:104110410-104110432 ATCTGTCAATGGAGCCAGCAAGG - Intronic
1123965314 15:25449950-25449972 TTTTGGCTCAGGAGCCAGCAGGG + Intergenic
1124116454 15:26847739-26847761 CTGAGCCAAATGAGACAGCAAGG - Intronic
1125970930 15:43911147-43911169 CCCTGGCCAAGGAGCCACCATGG - Intronic
1127875038 15:63104730-63104752 CTCTGCCAAAGGATACAGCAAGG + Intergenic
1128330557 15:66752911-66752933 GTTTGGCACAGGAGACAGCAAGG + Intronic
1128757768 15:70195096-70195118 CTGTGGGAAAGGACCCATGAGGG - Intergenic
1129044495 15:72721815-72721837 CTTTGGAAAAGGAGAAAGCAAGG - Intronic
1131113847 15:89782037-89782059 CTGAGTCAGAGGAGCCACCAAGG + Intergenic
1131449911 15:92530648-92530670 CTGGGGCAAAAGACCCAGAAAGG + Intergenic
1131869357 15:96745607-96745629 CTGTGGCTGAGGATCCAGCATGG - Intergenic
1132064809 15:98722051-98722073 CTCTGGCCAAGGAACTAGCAAGG - Intronic
1133444971 16:5852225-5852247 TTGAGGCAGAGGAGACAGCATGG - Intergenic
1135507789 16:23053733-23053755 GTGTTTCAAAGGAGGCAGCAAGG - Intergenic
1135587282 16:23680559-23680581 CTGTGGCAAAGAAGTCTGAAGGG - Intronic
1138246192 16:55468802-55468824 CTGTGGCTAAGAACACAGCAGGG + Intronic
1139356168 16:66368195-66368217 CTGTGGCAAAAGAGCCTTCCAGG - Intronic
1139680192 16:68555408-68555430 ATGGGGCAGAGGAGCCAGTATGG + Intronic
1141326283 16:83062614-83062636 CTGTCACACAGCAGCCAGCAGGG - Intronic
1141432151 16:83975840-83975862 CTCTGGCAAAAGTGCCAGCGCGG + Intronic
1143277436 17:5722196-5722218 CTCTGGCAAAGGATCCAGCTGGG - Intergenic
1143427798 17:6853949-6853971 CAGGGGCAGAGGAGGCAGCAGGG + Intergenic
1144221638 17:13105174-13105196 CTGTGGCACATGACCCAGCATGG + Intergenic
1144812608 17:18010233-18010255 CTGTGGCAGAGGAGAATGCAGGG + Intronic
1145997281 17:29111903-29111925 CTGTGGGAAAGGGGCCAGGGTGG + Intronic
1147548407 17:41420886-41420908 CTCTGGCCATGGAGCCAGCATGG - Exonic
1148090536 17:45020326-45020348 CTGAGGCAGAGGAGCTAGGAAGG + Intergenic
1149610261 17:57954557-57954579 CTGGGGCACAGGAGCCGGCGGGG + Intronic
1150847762 17:68676940-68676962 CTGTGGCAGATGAGCCTGCATGG + Intergenic
1150890967 17:69149419-69149441 GTGTGAAAAGGGAGCCAGCATGG - Intronic
1151068708 17:71183306-71183328 CTGAGGCAAGGGATCCAGCCAGG + Intergenic
1151819751 17:76491115-76491137 CTGTGGGTACGGAGCCAGCAGGG - Intronic
1152004140 17:77667117-77667139 GTGTGGCAAAGCAGCAAGGAAGG + Intergenic
1152379882 17:79936973-79936995 CTGAGGCAAAGTGGCCTGCAGGG + Exonic
1152558222 17:81065224-81065246 CTGTGGCCCAGGAGCAAGCCTGG + Intronic
1152741636 17:82020975-82020997 CGCCGGGAAAGGAGCCAGCACGG + Intronic
1154486098 18:14872334-14872356 CTGTGGCAAAGGAAACAGAGAGG + Intergenic
1158667213 18:59443293-59443315 CTGTGGCCCTTGAGCCAGCAAGG - Intronic
1160315100 18:77836333-77836355 ATGTGGCCAAGGAGCACGCAGGG - Intergenic
1160365636 18:78323827-78323849 AGGGGGCAAAGGAGCAAGCATGG + Intergenic
1160856000 19:1218254-1218276 CTGTGGGAAAGGGCCCTGCAGGG - Intronic
1161040727 19:2109599-2109621 GTGAGACCAAGGAGCCAGCAGGG - Intronic
1161156032 19:2732326-2732348 CTGTGCCTCAGGAGCCAGCTGGG - Intronic
1161196458 19:2989229-2989251 CTGTGGCAGAAGAGGCATCAAGG + Exonic
1161620561 19:5294825-5294847 CTGTGTCAAAGGGGCAGGCAGGG - Intronic
1164193295 19:22931138-22931160 CTGTGGAAAAGAAACCAGCTAGG - Intergenic
1164575248 19:29401982-29402004 CTGAGACAAAGGAGCCTCCAGGG + Intergenic
1165390340 19:35534941-35534963 CTGAGGAAAGGGAGACAGCAGGG - Intronic
1166080540 19:40441586-40441608 CGGTAGAAAAGGAGCCTGCACGG - Exonic
1166965296 19:46526264-46526286 GAGTGGCCAAGAAGCCAGCATGG + Intronic
1168012662 19:53545823-53545845 CTGTGACACAGGAGCCGGTACGG - Intronic
1168060274 19:53888027-53888049 CTGTTAAAAAGGAGACAGCACGG - Intronic
1168244794 19:55106832-55106854 CTGTTGCAAAGGTGACAGGAAGG - Intronic
1202707589 1_KI270713v1_random:35089-35111 CTGTGCCAAGAGACCCAGCAAGG + Intergenic
926923282 2:17960684-17960706 CTGTGTCAGAGGAGCTCGCAAGG - Intronic
927259862 2:21077420-21077442 AAGTGGCAAAGGAGTCAGAAGGG + Intergenic
928399701 2:30969035-30969057 CAGAGGGGAAGGAGCCAGCATGG + Intronic
928780808 2:34818181-34818203 CTGTGGCAGGGGAGGGAGCAAGG - Intergenic
929260773 2:39864281-39864303 CTGTGTGAAAGCAGCCAGGAGGG + Intergenic
930404866 2:50942255-50942277 CTGTGGGAATGGAGCCCACATGG + Intronic
930696278 2:54415162-54415184 GTCTGGCAAAGGAGCCAGGTGGG + Intergenic
930739282 2:54813486-54813508 CTGTGCCAGAAGAACCAGCAAGG - Intronic
931654803 2:64501343-64501365 GGGAGGCAAAGGAGCCAGCAGGG + Intergenic
936254611 2:110901119-110901141 TTGTGGCCAAGTATCCAGCAGGG - Intronic
936529393 2:113265232-113265254 CTGTGGCAAGAGAGCCAAGAAGG + Intronic
936865801 2:117075050-117075072 CTATGGGGAAGGAGCAAGCAGGG - Intergenic
937065837 2:119016984-119017006 CTGTGAGAAAGGAGCCAGGGAGG - Intergenic
938589344 2:132721748-132721770 CTGTGGCAATGCTGCCAGGAAGG - Intronic
938693734 2:133815967-133815989 TGGTGGCAGAGGAACCAGCAGGG - Intergenic
938791546 2:134680774-134680796 CTGTGGCACTGGAGCCAGAGAGG + Intronic
939878879 2:147607550-147607572 CTGTTGCAATGGAGTCACCATGG - Intergenic
941254495 2:163211555-163211577 CTGAGACAAAGGTGTCAGCAGGG + Intergenic
946094676 2:217263188-217263210 CTATGGGCGAGGAGCCAGCATGG - Intergenic
946110729 2:217413005-217413027 CTGTGGTACTGGAGCCAGCTGGG + Intronic
947347406 2:229207525-229207547 CTGAGGTAAAAGAGCCAGCTGGG + Intronic
948710358 2:239821451-239821473 CTGGGCCCAAGGAGGCAGCACGG + Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168859320 20:1034595-1034617 CTGGGCCAAAGGAGCCAGACTGG + Intergenic
1169131128 20:3166923-3166945 CAGTGGCAGTGGGGCCAGCAGGG - Exonic
1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG + Intronic
1169364385 20:4979412-4979434 CTGGGACAATGGGGCCAGCATGG + Intronic
1169696256 20:8390206-8390228 CTGAGACAAAAGTGCCAGCAGGG + Intronic
1170639248 20:18137558-18137580 CTGTGGGAGAGGGGTCAGCACGG + Intergenic
1170791166 20:19510752-19510774 CTGAGATAAAGGTGCCAGCATGG - Intronic
1172312536 20:33929700-33929722 CTGGGGCAAGGGAGCCACCATGG + Intergenic
1172741027 20:37167354-37167376 CCATGGCAAAGGATCCAGAAGGG - Intronic
1175488228 20:59360774-59360796 CTGTGGCACAGGCTGCAGCAGGG + Intergenic
1176014180 20:62920391-62920413 CTGCTGCAAAGGATTCAGCAAGG + Intronic
1176034963 20:63031713-63031735 GTGTGGCAGAGGAGCCCCCAGGG - Intergenic
1176204971 20:63883337-63883359 CTGGGGCCAAGGAGTGAGCAGGG + Intronic
1176795209 21:13367044-13367066 CTGTGGCAAAGGAAACAGAGAGG - Intergenic
1177244928 21:18510712-18510734 CTGTGGCAGTGGAGCCCTCATGG + Intergenic
1177510745 21:22084326-22084348 CTCGTGCAAAGGGGCCAGCATGG + Intergenic
1178240116 21:30889618-30889640 CTGTGGCTCAGGAGCATGCAGGG - Intergenic
1178247393 21:30967207-30967229 CTGAGACAAAGGTGCCAGCATGG + Intergenic
1180142854 21:45902770-45902792 CAGTGGCACAGACGCCAGCATGG + Intronic
1181050903 22:20237775-20237797 GGGTGGGAAAGGAGCCAGCTGGG + Intergenic
1181133046 22:20745323-20745345 GTGTGGCACAGCAGCCAGCCTGG - Intronic
1181343556 22:22201101-22201123 CTGTGGGGCAGGGGCCAGCAGGG - Intergenic
1183100560 22:35581196-35581218 CTGTGTTAAAGGCGTCAGCAGGG + Intergenic
1184116696 22:42426602-42426624 TTTTGGCAAAGGCGCCATCAGGG + Intronic
1184659890 22:45960867-45960889 CTATGGCTTTGGAGCCAGCAGGG + Intronic
1184773198 22:46609973-46609995 CCAAGGCAGAGGAGCCAGCAAGG - Intronic
1185103034 22:48851836-48851858 CTGAGACACAGGAGCCAGAAGGG + Intergenic
950021820 3:9792832-9792854 CTGTGGCAAAGGTGACAAGAAGG + Intronic
950025329 3:9816178-9816200 TTGTGGTAAAGGAGCCAGCCCGG - Intronic
950192763 3:10989266-10989288 CTGGAGCAAAGGAGCAGGCAGGG - Intergenic
950474442 3:13206706-13206728 CTGTGGGAAAGGAGGCAGGTGGG + Intergenic
950533851 3:13568420-13568442 CTGAGACACGGGAGCCAGCAGGG - Intronic
950773096 3:15327758-15327780 CTGTCACAAAGGAGCCAGGTGGG - Intronic
952208987 3:31210222-31210244 CTGAGGCAAAGCAACCTGCAGGG - Intergenic
953243986 3:41174570-41174592 CTCTGGCAAAGGAGGAGGCAAGG - Intergenic
954613752 3:51959244-51959266 GTGTGGCAAAGGGGACCGCATGG + Exonic
955400030 3:58585106-58585128 CTGCGGGTAAGGAGCCAGGAAGG - Intronic
958481505 3:94650936-94650958 CTGTTGTAAAGGAGTTAGCATGG - Intergenic
960378684 3:116933832-116933854 CTGTGGGAAATAAGCCAGCAAGG + Intronic
960983511 3:123254583-123254605 CTGAGGGAAACGAGCCAGTAGGG - Intronic
960996832 3:123345705-123345727 CTGTGACTGAGGAGCCACCAGGG - Intronic
961449703 3:126997019-126997041 CAGCGTCAAAGGAGCCAGCCAGG - Intronic
962428937 3:135301673-135301695 CAGTGCCCATGGAGCCAGCAGGG + Intergenic
962951104 3:140219683-140219705 CTGTGGAATTGGAGACAGCAGGG + Intronic
963049424 3:141128508-141128530 ATATGGCAGAGGAGCCAGGAGGG + Intronic
963270520 3:143281620-143281642 CTTTGGCAGGGGAGGCAGCAGGG + Intronic
963967955 3:151394672-151394694 TTGGGACAAAGGAGCCTGCAGGG - Exonic
964917583 3:161854999-161855021 CAGGGGCAGAGGAGGCAGCAGGG - Intergenic
965492960 3:169362498-169362520 ATATGGCAAAGAAGCAAGCAAGG + Intronic
968438708 4:610481-610503 GAGTGGCAGAGGAGCCAGGAGGG + Intergenic
968622907 4:1611700-1611722 CGGTGGGCAAGGGGCCAGCATGG + Intergenic
969234716 4:5857763-5857785 CTGTGCCAAAGGAGGTAGCTTGG - Intronic
969489670 4:7491883-7491905 CTGTGGGAAGGCAGACAGCAGGG + Intronic
970309557 4:14767906-14767928 CTGTGGCATGGGAGGCAGCAAGG - Intergenic
971789862 4:31155580-31155602 CTGTGGCCAAGAAGACATCAAGG - Intergenic
972739286 4:41875187-41875209 CATTGGCAAAGCAGCTAGCAAGG - Intergenic
973730958 4:53821844-53821866 CCCTGGGGAAGGAGCCAGCAAGG + Intronic
973900767 4:55468375-55468397 CTGTGGCACAGCACCTAGCATGG + Intronic
974442419 4:61937278-61937300 GTGTGGCAAATGAGGCAGGAAGG - Intronic
976895214 4:90101176-90101198 CTGTGTCAGAGTAGCCAGAAAGG + Intergenic
977103698 4:92852389-92852411 CTGAGGGAAAGGAGCTAGTAGGG - Intronic
977748614 4:100581079-100581101 CTGAGGTAAGGGTGCCAGCATGG - Intronic
978544695 4:109858348-109858370 CTGTTGTAAAGGAGTTAGCATGG + Intronic
983690574 4:170464842-170464864 TTGTGGCAAGGGAGACAGGAAGG + Intergenic
985018484 4:185661952-185661974 CTGGGGCAGAGGACCCAACATGG - Intronic
986053142 5:4108904-4108926 CTGTGGCCAAGGTGTCAGCAGGG + Intergenic
987103546 5:14614732-14614754 GTGTGGCCCAAGAGCCAGCATGG + Intronic
987884034 5:23789492-23789514 CTGAGACAAGGGTGCCAGCATGG + Intergenic
987917121 5:24228627-24228649 CTGTTGCACAGGAGTCTGCATGG + Intergenic
992486474 5:77201887-77201909 CTCAGGTAAAGGTGCCAGCAGGG + Intergenic
992987825 5:82251534-82251556 CTGGAGCAGAGTAGCCAGCATGG + Intronic
994164729 5:96596808-96596830 CTGAGACGAAGGTGCCAGCAGGG + Intronic
995044273 5:107626651-107626673 TTAAGGCAAAGGACCCAGCATGG - Intronic
995736173 5:115302182-115302204 CTGTGGAAAATGAGCAAGCAGGG - Intergenic
996451403 5:123629311-123629333 CAGTAGCAATGGAGGCAGCATGG - Intergenic
996537451 5:124593306-124593328 ATGTGGCAAAAGGGCCAGTAAGG + Intergenic
996873301 5:128215619-128215641 CTATGGAAAAGGAGACAGCAGGG + Intergenic
997136214 5:131329166-131329188 CTGTGGCTAAGGGGCAATCAAGG + Intronic
998046668 5:138992487-138992509 CTGTGGAAAAGGAGCCTGCTAGG - Intronic
1001080454 5:168663559-168663581 CTGGGCCACAGGTGCCAGCAGGG - Intronic
1001306382 5:170576956-170576978 CTGTGGGAAGGGACCCAGCAGGG + Intronic
1001575500 5:172761049-172761071 CTGAGGCAAGGAAGCCAGCTTGG + Intergenic
1001770548 5:174292973-174292995 CTGTGCCACAGGGGCCTGCAAGG + Intergenic
1002044063 5:176532316-176532338 CTGGGGCATGGGGGCCAGCAGGG - Intronic
1002692553 5:181060137-181060159 CGGTGGGCAAGAAGCCAGCATGG + Exonic
1002772374 6:300984-301006 CTTTGGCAACAGAGGCAGCAGGG - Intronic
1002936988 6:1682449-1682471 CAGTGGCAATGGCACCAGCATGG - Intronic
1003074607 6:2971921-2971943 TTGCGGCAAAGAAGCCAGCCAGG + Intronic
1003864164 6:10348408-10348430 CTGTGGCAAATGAAGCAGAAGGG + Intergenic
1004321965 6:14639010-14639032 CTGTTGAAAGGGAGCCAGTATGG - Intergenic
1005190493 6:23216312-23216334 CTGAGATCAAGGAGCCAGCATGG + Intergenic
1006104837 6:31710329-31710351 CTGGGGAGAAGGAGCCATCAGGG - Intronic
1007655730 6:43450041-43450063 CTGCTGCAGAGCAGCCAGCAGGG + Exonic
1008272297 6:49504187-49504209 CTGTTGTAAAGGAGTTAGCATGG + Intronic
1008842695 6:55923024-55923046 CTGTAGCAAAGGATTCATCAAGG + Intergenic
1012924858 6:105257050-105257072 CTATGGCAAAGGTGACAGGAAGG + Intergenic
1013635380 6:112024439-112024461 CTGAGGCAAAGGAGGATGCAGGG - Intergenic
1014405553 6:121046393-121046415 CTGTTGTAAAGGAGTTAGCATGG - Intergenic
1017202352 6:151769208-151769230 CTGTGGCCCAGAAGCCAGCGTGG - Intronic
1017523323 6:155221023-155221045 CTGTGGCACAGAAAACAGCAGGG - Intronic
1017743694 6:157428280-157428302 CTATGGCAGAGGAGCTGGCAAGG - Intronic
1018093159 6:160362880-160362902 CCGCGGCCAAGGAGCCAGGAGGG + Intronic
1018295932 6:162343980-162344002 CTGTGGTAAAGGTGCCAGAGAGG - Intronic
1020251183 7:6469724-6469746 CTGTGGCATAGGAGCAGGCAAGG + Exonic
1023409305 7:39873075-39873097 TTGTGTCACAGGAGTCAGCAAGG - Intergenic
1023689539 7:42772193-42772215 CAGTGGGAATGGAGGCAGCAAGG - Intergenic
1023940515 7:44766095-44766117 CGCTGGCAGAGGAGCCAGGAGGG - Intronic
1024062032 7:45704985-45705007 CTGTGGAAAAGGAGAGTGCAAGG - Intronic
1025043629 7:55670954-55670976 TTGTGTCACAGGAGTCAGCAAGG + Intergenic
1025736109 7:64148249-64148271 CTGTGGGGAAAGAGACAGCAGGG + Intronic
1026850428 7:73719893-73719915 CTGGGGCAGAGGAGGCAGCAGGG - Intergenic
1027309278 7:76937284-76937306 CTGAGGCAAAGGAGCATCCAGGG - Intergenic
1028642018 7:93053040-93053062 CTGTGGAACAGGTGTCAGCAAGG - Intergenic
1029045312 7:97621594-97621616 CTCAGGCAGTGGAGCCAGCATGG - Intergenic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1030293456 7:107895037-107895059 CTGTGGCAAAGCATCCAGTATGG + Intronic
1033014777 7:137661217-137661239 CAGTAGGAAAAGAGCCAGCATGG + Intronic
1033230802 7:139595943-139595965 CCAGTGCAAAGGAGCCAGCAGGG + Intronic
1034027457 7:147721680-147721702 ATGGGGCAAAGGAGCCAGGAAGG - Intronic
1034178084 7:149116079-149116101 CCGAGGCCCAGGAGCCAGCAGGG - Intronic
1035564703 8:633749-633771 CTTTGGCACAGGTGCCAGGATGG + Intronic
1035659178 8:1333945-1333967 CGGTGGCACAGGGGCCAACACGG + Intergenic
1035781189 8:2229411-2229433 CTGTGGGGAAGGAGGCTGCAAGG - Intergenic
1038490695 8:27968686-27968708 ATGAGGCTAAGGAGACAGCAGGG - Intronic
1041269310 8:56095111-56095133 TAGTGGCAAGAGAGCCAGCAGGG + Intergenic
1044512382 8:93097358-93097380 CAGTGGCAAAGGAGGGAGAAAGG + Intergenic
1048450609 8:134530045-134530067 CTGTGGCATAGCAGGCAGGAGGG + Intronic
1049303309 8:141883312-141883334 GGGCGGCAAGGGAGCCAGCAAGG - Intergenic
1049389324 8:142360014-142360036 CTGTGCCACAGAAGCCAGGAAGG + Intronic
1057795863 9:98157594-98157616 CTTTGGCAAACCAGCCAGCAAGG - Exonic
1057912507 9:99031100-99031122 CTGTGGCAAAGGAGCCAGCAGGG - Intronic
1058193764 9:101950298-101950320 CAGTGGCAAGGTAGCCAGGAGGG + Intergenic
1060758879 9:126232312-126232334 CTGAGGTCAAGGTGCCAGCAGGG - Intergenic
1061147319 9:128807708-128807730 CTGAGGCCCAGGATCCAGCATGG + Intronic
1061327119 9:129870513-129870535 CAGCGGCAAAGAAGGCAGCAAGG - Exonic
1061332525 9:129904716-129904738 CTGTGGGAAAGAAGGCAGGAAGG - Intronic
1061751089 9:132777460-132777482 CTGTAGCCAGGGAGGCAGCAGGG - Intronic
1062000821 9:134214814-134214836 CTGTTGTCAGGGAGCCAGCATGG + Intergenic
1062044861 9:134420280-134420302 CTGAGGCTAAGAAGCCAGCCTGG + Intronic
1062069165 9:134546203-134546225 CTGTGGCTAAGGAAACACCAAGG - Intergenic
1062173211 9:135146935-135146957 CTGGGGCTGGGGAGCCAGCATGG - Intergenic
1062189795 9:135242138-135242160 GTGTGGCAGAGGCGCCAGCGAGG - Intergenic
1062356861 9:136169201-136169223 CTGTGGCCAAGGAGGGGGCAAGG + Intergenic
1186518557 X:10185814-10185836 GTGTGGAAATGGAGGCAGCAGGG + Intronic
1186610750 X:11135955-11135977 CTCTGGCAAAGGGGCCAGAATGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187552629 X:20321544-20321566 TTGTTGCAAAGGAGACGGCAAGG + Intergenic
1188401805 X:29754904-29754926 GTGAAGCAAAGGACCCAGCATGG - Intronic
1189280061 X:39814896-39814918 CTGTAGCAAAGCAGTCAGGAAGG - Intergenic
1195321176 X:103723305-103723327 CTGTGGCAGGGGTGCCAGCCTGG - Intronic
1195385394 X:104309361-104309383 CTGTGACCAAGGTTCCAGCAGGG + Intergenic
1196130431 X:112149561-112149583 GGGTAGCAAAGGGGCCAGCATGG + Intergenic
1196175969 X:112639297-112639319 CTCTGGCAAAGGAGCCTGGCAGG - Intronic
1197245700 X:124164162-124164184 CTGTGGGAAAGTAGCCACAAGGG + Intronic
1198430096 X:136556738-136556760 CTGTTACACAGGAGCAAGCAGGG - Exonic
1198697780 X:139362092-139362114 GTGAGGCAATGGAGCAAGCAAGG + Intergenic
1199771162 X:150976208-150976230 CGGTGGGAAAGGAGCCACCGGGG - Intergenic
1201862209 Y:18611353-18611375 CTGGGGTAAAGGAGTCATCAGGG - Intergenic
1201863099 Y:18621176-18621198 CTGGGGTAAAGGAGTCATCAGGG - Intergenic
1201870224 Y:18699202-18699224 CTGGGGTAAAGGAGTCATCAGGG + Intergenic
1201871114 Y:18709027-18709049 CTGGGGTAAAGGAGTCATCAGGG + Intergenic