ID: 1057913029

View in Genome Browser
Species Human (GRCh38)
Location 9:99035020-99035042
Sequence CCAGGTAAGCCTCTGTTGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 171}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057913029_1057913041 4 Left 1057913029 9:99035020-99035042 CCTGGCAACAGAGGCTTACCTGG 0: 1
1: 0
2: 2
3: 12
4: 171
Right 1057913041 9:99035047-99035069 CCGGGGAAAAAGGGACAAGCTGG 0: 1
1: 0
2: 0
3: 17
4: 183
1057913029_1057913034 -6 Left 1057913029 9:99035020-99035042 CCTGGCAACAGAGGCTTACCTGG 0: 1
1: 0
2: 2
3: 12
4: 171
Right 1057913034 9:99035037-99035059 ACCTGGACCCCCGGGGAAAAAGG 0: 1
1: 0
2: 2
3: 8
4: 114
1057913029_1057913045 21 Left 1057913029 9:99035020-99035042 CCTGGCAACAGAGGCTTACCTGG 0: 1
1: 0
2: 2
3: 12
4: 171
Right 1057913045 9:99035064-99035086 AGCTGGCCCTCCTGGGGTCATGG 0: 1
1: 0
2: 2
3: 32
4: 644
1057913029_1057913042 13 Left 1057913029 9:99035020-99035042 CCTGGCAACAGAGGCTTACCTGG 0: 1
1: 0
2: 2
3: 12
4: 171
Right 1057913042 9:99035056-99035078 AAGGGACAAGCTGGCCCTCCTGG 0: 1
1: 0
2: 0
3: 17
4: 275
1057913029_1057913044 15 Left 1057913029 9:99035020-99035042 CCTGGCAACAGAGGCTTACCTGG 0: 1
1: 0
2: 2
3: 12
4: 171
Right 1057913044 9:99035058-99035080 GGGACAAGCTGGCCCTCCTGGGG 0: 1
1: 0
2: 0
3: 18
4: 209
1057913029_1057913036 -5 Left 1057913029 9:99035020-99035042 CCTGGCAACAGAGGCTTACCTGG 0: 1
1: 0
2: 2
3: 12
4: 171
Right 1057913036 9:99035038-99035060 CCTGGACCCCCGGGGAAAAAGGG 0: 1
1: 0
2: 1
3: 8
4: 126
1057913029_1057913043 14 Left 1057913029 9:99035020-99035042 CCTGGCAACAGAGGCTTACCTGG 0: 1
1: 0
2: 2
3: 12
4: 171
Right 1057913043 9:99035057-99035079 AGGGACAAGCTGGCCCTCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 220
1057913029_1057913046 22 Left 1057913029 9:99035020-99035042 CCTGGCAACAGAGGCTTACCTGG 0: 1
1: 0
2: 2
3: 12
4: 171
Right 1057913046 9:99035065-99035087 GCTGGCCCTCCTGGGGTCATGGG 0: 1
1: 0
2: 1
3: 21
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057913029 Original CRISPR CCAGGTAAGCCTCTGTTGCC AGG (reversed) Exonic
900539996 1:3197820-3197842 CCAGGGAGACCTCTGTGGCCTGG - Intronic
900910765 1:5595651-5595673 CCAGGGGAGACTCTGTTCCCGGG - Intergenic
901600450 1:10419536-10419558 CCAGGTAAGCCTGTGGAGCAGGG + Exonic
902704853 1:18197557-18197579 CCAGGCAAGTTTCTGCTGCCTGG - Intronic
905034109 1:34905984-34906006 CCAGGTCTCGCTCTGTTGCCTGG - Intronic
905409971 1:37761843-37761865 CCAGGTCGGCCTCAGTTTCCAGG + Exonic
905976360 1:42177134-42177156 CCAGGTAACCCTGTCTGGCCAGG + Exonic
907323150 1:53618311-53618333 CCACTCAAGCCTCTGCTGCCAGG + Intronic
912718743 1:112002201-112002223 CCAGGTCAGGCTGTGCTGCCTGG + Intergenic
914512117 1:148343334-148343356 CCAGCTCAGCCTGAGTTGCCTGG - Intergenic
914788847 1:150858638-150858660 CCAGGTCTCACTCTGTTGCCTGG + Intronic
915772588 1:158444007-158444029 CCAGCTAAGCCCCTTGTGCCAGG - Intergenic
917426808 1:174922981-174923003 CAAGGTCTCCCTCTGTTGCCCGG - Intronic
918251653 1:182708438-182708460 CCAGGTGTGCCTCTGTAGACAGG - Intergenic
920690874 1:208145418-208145440 CCAGTTAACCCTCTGCTGGCTGG + Intronic
921245603 1:213235966-213235988 CCAGGTACCCGTCTGTGGCCCGG - Intronic
922348949 1:224720406-224720428 CCAGGTGAGGCTCTGCTGCCAGG - Intronic
922799503 1:228358717-228358739 CCAGGTCCTCCTCTGGTGCCCGG - Intronic
923296292 1:232597768-232597790 CAAGATCAGCCTCTCTTGCCTGG - Intergenic
1064458427 10:15509925-15509947 CTAGGGAAGCATCTGTTTCCAGG - Intergenic
1066057417 10:31695160-31695182 CCAAGAAAGACCCTGTTGCCTGG + Intergenic
1068658699 10:59601427-59601449 CCAGCTAAGTCTCTGCAGCCTGG - Intergenic
1069304991 10:66957971-66957993 AAAGGTGAGCCTCTGTGGCCTGG + Intronic
1070974727 10:80597302-80597324 GCATGTAAGCCTCTTTTTCCAGG - Intronic
1072495999 10:95960535-95960557 CAAGGTCTCCCTCTGTTGCCTGG + Intronic
1073512164 10:104049444-104049466 CCAGGCAAACCTCTCATGCCAGG + Exonic
1076033455 10:127178508-127178530 CCAGGCAAGACTCTGCTCCCAGG - Intronic
1078148191 11:8736584-8736606 TCAGGGAAGCCCCTCTTGCCAGG + Intronic
1079172967 11:18113614-18113636 CCAGGGAACCCTCAGTTCCCTGG + Intronic
1084119288 11:67059654-67059676 CCAGGTAAGCCTCTGGGTTCTGG - Intronic
1084147420 11:67272477-67272499 CCAGGCCATCCTCTGTGGCCTGG - Intronic
1084342947 11:68520430-68520452 CTAGGTCAGACTTTGTTGCCTGG + Intronic
1084647939 11:70471499-70471521 CCAGGTCAGCCTCTCTGGCAAGG - Intronic
1085022669 11:73218965-73218987 ACAGTTAAGCCTCTGTCCCCGGG + Intronic
1085713608 11:78852656-78852678 CCAGGTCTCACTCTGTTGCCTGG - Intronic
1086820985 11:91435923-91435945 GCAGGCAAGCCTCTCTGGCCTGG + Intergenic
1088805018 11:113344437-113344459 CCAGGTAAGCCTCTGCTGGCAGG + Exonic
1089857258 11:121557064-121557086 CCATGTAAGCCCCAGTTTCCAGG - Intronic
1090012435 11:123057183-123057205 CCAGGAAAGCCTCTGCTCCTAGG + Intergenic
1091360013 11:134971827-134971849 GCAGAGAAGCCTCTGTTTCCCGG + Intergenic
1093833444 12:23795684-23795706 ACAGCAAAGGCTCTGTTGCCTGG - Intronic
1096396295 12:51269384-51269406 CCAGGAAAGCCTCTGGTGCCAGG + Intronic
1096546481 12:52343675-52343697 CCAGGGGAGCATCTGTTTCCAGG + Intergenic
1096660974 12:53123816-53123838 CCAGGTCAGCCTGTACTGCCAGG + Exonic
1097494113 12:60308566-60308588 CCAGGTGAGCATATATTGCCTGG - Intergenic
1108190408 13:47932675-47932697 CCAGGTAAGGATCTTTTGCCAGG - Intergenic
1109149895 13:58833113-58833135 CAGGGTCACCCTCTGTTGCCAGG - Intergenic
1114076816 14:19165650-19165672 CCTGGTAGACCTCTGGTGCCAGG - Intergenic
1114085345 14:19233918-19233940 CCTGGTAGACCTCTGGTGCCAGG + Intergenic
1118942619 14:70352209-70352231 CCAAGTCTCCCTCTGTTGCCTGG + Intronic
1119223353 14:72926540-72926562 ACAGGTAAGACTGTGCTGCCTGG + Exonic
1120989389 14:90361866-90361888 CCAGGTATGCCTGTGTAGGCTGG - Intergenic
1121027245 14:90625588-90625610 CCAGGTGAGCCTATGATGCTGGG + Intronic
1122369472 14:101221407-101221429 CCAGTGATGCCTCTGTTGCTGGG + Intergenic
1124267839 15:28253200-28253222 CAAGGTTAGCCTCTGTTCACAGG + Intronic
1124446744 15:29740946-29740968 CCAGGTAAGCATTTGTTGTGAGG - Intronic
1126750639 15:51873389-51873411 CCAGGAAAACCTCTATTGCCTGG - Intronic
1132063404 15:98711270-98711292 TCAGGTAATCTTCTGTTGGCTGG + Intronic
1132463338 16:66359-66381 CGAGGCAAGCCTGTGTTTCCTGG - Intronic
1133140896 16:3743242-3743264 CCAGGTAACCCTCTGTTTTAGGG - Intronic
1133577070 16:7102177-7102199 CCAGTTAAGCCACTGTTTGCAGG + Intronic
1134043845 16:11087284-11087306 CCAGGTGAGGCTCTGTGGGCAGG - Intronic
1134630855 16:15755111-15755133 CCAGATCGGACTCTGTTGCCAGG + Intronic
1137061602 16:35795542-35795564 CAATGAAAGCCACTGTTGCCTGG - Intergenic
1139250197 16:65488043-65488065 CCAAATAAACCTCTGTGGCCTGG + Intergenic
1141102930 16:81211191-81211213 CCAGCTCAGCCCCTGCTGCCTGG - Intergenic
1141644558 16:85360318-85360340 CCAGGTCAGCCGTTGTTGCAGGG - Intergenic
1141963802 16:87427324-87427346 TCAGGGAAGCCTCACTTGCCAGG + Intronic
1142191484 16:88720217-88720239 CCAGGAAAGCCTCGGGTACCTGG + Exonic
1142970762 17:3610003-3610025 CCAGCTAAGCATCTGCAGCCAGG + Exonic
1143205134 17:5135969-5135991 CCGGGAAAGCCACTGTGGCCAGG + Intronic
1144574329 17:16419405-16419427 CCAGGTAATGCTCTGTTTCTGGG + Intronic
1144948471 17:18981733-18981755 GCAGATAAGCCTCTGCTCCCAGG + Intronic
1146454436 17:32997991-32998013 GGAGGTAAGCCTCTGGTGCTGGG - Intergenic
1146480439 17:33200925-33200947 CCAGGCAAGCCCCTGCTGCAGGG + Intronic
1154495099 18:14950182-14950204 GCAGAGAAGCCTCTGTTTCCTGG - Intergenic
1155469613 18:26177327-26177349 CCAGCTAATCCTCTGTTGTGAGG - Intronic
1157042640 18:44059097-44059119 CCAGCTAACCATCTGCTGCCAGG + Intergenic
1162050109 19:8027809-8027831 CCAGGGAAGCCCCTGTACCCTGG - Intronic
1162081539 19:8220706-8220728 CAAGGGCAGCCTGTGTTGCCAGG + Intronic
1162349388 19:10139546-10139568 CCATGCCAGCCTCTGCTGCCTGG + Intronic
1162728395 19:12703113-12703135 CCAGAGAAGCCTCTGTTGTTTGG - Intronic
1162737755 19:12755932-12755954 CCAGGTGAGACTCAGTTTCCAGG + Exonic
1163672915 19:18638889-18638911 CCAGGTCTTGCTCTGTTGCCAGG + Intronic
1164669801 19:30066053-30066075 ACAGGTAAGGCTTTGTTGGCTGG + Intergenic
1165155722 19:33786247-33786269 CCAGGTAAGCCCCTGAGACCAGG + Intergenic
1165232594 19:34396427-34396449 CAAGGTAGGCCCCTGTGGCCTGG + Exonic
1168693685 19:58393182-58393204 CGAGGTAGGGCTCTGTGGCCTGG + Exonic
926564987 2:14459130-14459152 CAAGGTTTGGCTCTGTTGCCTGG - Intergenic
927827642 2:26319739-26319761 CAAGGTCTCCCTCTGTTGCCCGG + Intronic
928621195 2:33089529-33089551 CCAGGTAATTCTCTGTTGTAGGG - Intronic
934186288 2:89679422-89679444 GCAGGTATGCCTGTGTTGGCAGG + Intergenic
934516106 2:94987748-94987770 CCAGGGAAGCTTCTGATGGCAGG + Intergenic
936935762 2:117836804-117836826 CCTGGTAACCGTCTGTTACCAGG - Intergenic
937474008 2:122198382-122198404 GCAGGTGAGCCTCTGTGTCCTGG + Intergenic
937514423 2:122637487-122637509 CCAGGTAGGCCTTAGCTGCCTGG + Intergenic
938251234 2:129817208-129817230 CCAGGTGACCCTCTGTCACCTGG + Intergenic
940315333 2:152322118-152322140 CAAGGTATCACTCTGTTGCCAGG + Intergenic
941487183 2:166097044-166097066 CGGGGTCAGGCTCTGTTGCCCGG + Intronic
948104534 2:235402669-235402691 GCAGGTAAGCTTCTGTTGCTAGG - Intergenic
949058051 2:241939952-241939974 CCAGGTGAACCTCTGGAGCCCGG + Intergenic
1168801264 20:644837-644859 CCAGGTCTTGCTCTGTTGCCTGG - Intergenic
1169771155 20:9202411-9202433 CCAGTTATACCTCTGATGCCAGG + Intronic
1171095799 20:22331460-22331482 CCAGATGAGCCCCTGATGCCAGG + Intergenic
1171106261 20:22435662-22435684 TCAGGGAAGCCTCAGCTGCCTGG + Intergenic
1172041652 20:32050927-32050949 CCAGGTAATTCTTTGTTGCGGGG - Intergenic
1172572287 20:35980137-35980159 CCAGGGAAGCCTGTATTGCCTGG + Intronic
1174557025 20:51403095-51403117 CCAGGGATGCCTCTGCTTCCAGG - Intronic
1174604668 20:51752218-51752240 CCTGCTAAGCCTCCGTTTCCTGG + Intronic
1175288970 20:57860541-57860563 CCAGGAAACCCTCTGCAGCCAGG - Intergenic
1177229774 21:18304896-18304918 CCAAGTGAGACTTTGTTGCCAGG - Intronic
1178223549 21:30688546-30688568 GCAGGTTACCCTCTGTAGCCTGG + Intergenic
1178849862 21:36204214-36204236 CCAGGTAAGTCTTTGTTGTCGGG - Intronic
1179025715 21:37676809-37676831 CCAGGTCACTCTCTGTTGCAGGG - Intronic
1179475305 21:41639463-41639485 CCAGGCAAGGCTCTGCTGCTGGG - Intergenic
1180292626 22:10859275-10859297 CCTGGTAGACCTCTGGTGCCAGG - Intergenic
1180495431 22:15888697-15888719 CCTGGTAGACCTCTGGTGCCAGG - Intergenic
1182448892 22:30406544-30406566 CTATGAAAGCCTGTGTTGCCAGG - Intronic
1183403574 22:37618891-37618913 CCAGGTAGGGTTCTGTGGCCAGG - Intronic
1184233534 22:43171144-43171166 CCTGGAAGGCCTCTGTGGCCTGG - Intronic
1184383700 22:44162200-44162222 TCAGGGAAGCCTCTTTTTCCTGG + Intronic
1184421957 22:44387239-44387261 CCAGGCCAGCCTCTCTTACCAGG + Intergenic
1184767537 22:46579452-46579474 CCTAGTGAGCCTCTGCTGCCAGG + Intronic
949624797 3:5853527-5853549 CCAGTGAAGCCTCTGTTGCTAGG + Intergenic
950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG + Intronic
950528640 3:13539785-13539807 CCAGGTCAGACTCTGGAGCCAGG - Intergenic
956513851 3:70024529-70024551 GCAGCAAAGCCTCTGATGCCAGG + Intergenic
957509713 3:81171519-81171541 CCAGGTGAACCTCTGTTCCTTGG + Intergenic
958970029 3:100601095-100601117 CCAAGTAGGCCACTCTTGCCTGG - Intergenic
962116431 3:132513792-132513814 CCTGGGAAGTCTCGGTTGCCTGG - Intronic
963011012 3:140770488-140770510 CCAGGTGAACCACAGTTGCCAGG - Intergenic
963582653 3:147146512-147146534 CCTGGTAATCCTTTGTTGCAAGG - Intergenic
965901172 3:173644045-173644067 CCAGGTTAACCTTTGTTGGCTGG - Intronic
966828172 3:183982953-183982975 GCAGGTTAGACTCTGTTGCCTGG + Exonic
969843719 4:9902609-9902631 CCAGGGAAGGGTCTGTTGCAGGG + Intronic
971490439 4:27206498-27206520 CCAGGAAAGCCTCAGTTTCCCGG - Intergenic
976523975 4:86064928-86064950 CAGGGTATCCCTCTGTTGCCAGG + Intronic
977947975 4:102935917-102935939 GCAGGTATGCCTGTGTTGGCAGG - Intronic
978661120 4:111127797-111127819 CCAGGTAAGAATCTGTTTCCTGG + Intergenic
980476110 4:133319162-133319184 CAAGGTCAGGCTCTGTTGCCAGG + Intergenic
980768343 4:137337592-137337614 CAAGGTATCACTCTGTTGCCTGG + Intergenic
982813620 4:159857623-159857645 CCAGGGAAGCCTTGTTTGCCAGG + Intergenic
984822390 4:183893246-183893268 CCAGGTAAGCGGCAGTTCCCTGG + Intronic
991130988 5:63122152-63122174 CCAGGCCAGCTTCTGATGCCTGG - Intergenic
993702563 5:91135641-91135663 CCAGAAAAGCCTGTATTGCCTGG - Intronic
999276954 5:150337900-150337922 CCTGGGAAGCCTCTGTTGATGGG - Intronic
999468688 5:151831565-151831587 TCAGCAAAGCCTCTGTAGCCAGG + Intronic
1000421677 5:161045120-161045142 CCAGGTATGCCTCTGGCCCCAGG - Intergenic
1001649324 5:173304205-173304227 CCAGCTAGGTCCCTGTTGCCAGG + Intergenic
1003017799 6:2481983-2482005 CCAGGTTAGCCTTTGTGGCTTGG + Intergenic
1003378188 6:5598356-5598378 CAAGGTCTCCCTCTGTTGCCTGG - Intronic
1006774369 6:36580592-36580614 CCAGGTGAGACTCTGGAGCCTGG - Intergenic
1007938095 6:45751773-45751795 CCAGGAAAGTCTCTCTAGCCAGG + Intergenic
1010064932 6:71671474-71671496 CAAGGTAGGCCTCTGTTTCTAGG + Intergenic
1012332965 6:98016904-98016926 CCATGTAAGCCTCCTTTTCCAGG - Intergenic
1013313703 6:108921407-108921429 CCAAGTAGGCCTGTGTAGCCAGG + Intronic
1013857602 6:114592724-114592746 CCAGCCAACCCTCAGTTGCCCGG + Intergenic
1014137175 6:117903768-117903790 CATGGTAAGTCTCTGTTGACAGG - Intergenic
1015289345 6:131520526-131520548 CCAGGAAAAGCTCTGTGGCCTGG - Intergenic
1016277340 6:142370207-142370229 CCTGGTAAGCATCTGATGTCTGG - Exonic
1016427750 6:143952597-143952619 CCAGGAAAGACTGTGTTCCCAGG + Intronic
1018950117 6:168373591-168373613 CCATGCCTGCCTCTGTTGCCCGG + Intergenic
1019341561 7:511120-511142 CCAGCTCAGCCTCTGCTGCCTGG - Intronic
1019759669 7:2801110-2801132 CCATCCAAGCCACTGTTGCCAGG - Intronic
1028753872 7:94412644-94412666 CCAGGGAATCCAATGTTGCCAGG - Exonic
1034438293 7:151074141-151074163 CCAGCCAAGCTCCTGTTGCCCGG - Exonic
1035058335 7:156051501-156051523 CCAGGGAGCCCTGTGTTGCCTGG + Intergenic
1036706771 8:11052501-11052523 CGAGGTAAGGCTCTGTTGAATGG + Intronic
1037070917 8:14647962-14647984 CCAGGTGTGCTTCTGGTGCCTGG - Intronic
1041095007 8:54341420-54341442 GCAGGTAAGCCTCAGGGGCCTGG - Intergenic
1045557444 8:103228217-103228239 CCAGGTAAGACAGTCTTGCCAGG - Exonic
1046772082 8:118126323-118126345 CAAGGTCTCCCTCTGTTGCCTGG - Intergenic
1048010447 8:130451154-130451176 CGGGGTAAGCCTCAGTTTCCTGG + Intergenic
1052582354 9:30374175-30374197 CCAGTGAAGCCTTTGTGGCCTGG - Intergenic
1056553151 9:87667496-87667518 CCAGGCAATTCTCTGTTGCTGGG - Intronic
1057571489 9:96207364-96207386 ACAGCTAGGCCTCTGTTTCCAGG - Intergenic
1057828574 9:98389957-98389979 CCAGTTATGCCTCTCTTCCCAGG + Intronic
1057913029 9:99035020-99035042 CCAGGTAAGCCTCTGTTGCCAGG - Exonic
1059840304 9:118207816-118207838 CAAGATTAGCCTCTGTTGCGTGG + Intergenic
1185562923 X:1074410-1074432 CAAGGTATGCCTCTGATGTCGGG - Intergenic
1195380664 X:104267863-104267885 GCAGGGTCGCCTCTGTTGCCTGG - Intergenic
1195757556 X:108214191-108214213 CCAGGTGGGCCTCTGGGGCCTGG + Exonic
1198251514 X:134883566-134883588 CCAGGTAAGCCCATGCTGCTGGG + Intergenic
1199607330 X:149586916-149586938 CCAGGGAAGCCCCAGGTGCCCGG - Intronic
1199631793 X:149782451-149782473 CCAGGGAAGCCCCAGGTGCCCGG + Intronic
1200161112 X:154010002-154010024 CAAGGTCTCCCTCTGTTGCCCGG + Intergenic