ID: 1057919576

View in Genome Browser
Species Human (GRCh38)
Location 9:99085994-99086016
Sequence CCAGCAACTGAGATTGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057919576_1057919583 0 Left 1057919576 9:99085994-99086016 CCTCATTCAATCTCAGTTGCTGG No data
Right 1057919583 9:99086017-99086039 GGGATGGTCACGCCTAGGTCAGG No data
1057919576_1057919585 15 Left 1057919576 9:99085994-99086016 CCTCATTCAATCTCAGTTGCTGG No data
Right 1057919585 9:99086032-99086054 AGGTCAGGTGATAGTCTTTGTGG No data
1057919576_1057919586 20 Left 1057919576 9:99085994-99086016 CCTCATTCAATCTCAGTTGCTGG No data
Right 1057919586 9:99086037-99086059 AGGTGATAGTCTTTGTGGCCAGG No data
1057919576_1057919582 -5 Left 1057919576 9:99085994-99086016 CCTCATTCAATCTCAGTTGCTGG No data
Right 1057919582 9:99086012-99086034 GCTGGGGGATGGTCACGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057919576 Original CRISPR CCAGCAACTGAGATTGAATG AGG (reversed) Intergenic
No off target data available for this crispr