ID: 1057920886

View in Genome Browser
Species Human (GRCh38)
Location 9:99095656-99095678
Sequence CTGTGTAATGGGGAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057920886_1057920894 -5 Left 1057920886 9:99095656-99095678 CCTTCCCCCTCCCCATTACACAG No data
Right 1057920894 9:99095674-99095696 CACAGACAAAAGTCACTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057920886 Original CRISPR CTGTGTAATGGGGAGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr