ID: 1057926047

View in Genome Browser
Species Human (GRCh38)
Location 9:99150714-99150736
Sequence GCACCCTTGTTACTTGGGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057926047 Original CRISPR GCACCCTTGTTACTTGGGAG AGG Exonic
900480297 1:2894913-2894935 GCACCCGTGGTACTTGGTGGCGG - Intergenic
900505826 1:3029377-3029399 GAGCCCTTGTCACCTGGGAGGGG + Intergenic
900682106 1:3922585-3922607 GTTCTCTTGTTACTTGGGTGTGG + Intergenic
905457471 1:38098044-38098066 CCCGCCTTGTTACATGGGAGAGG + Intergenic
906085200 1:43127090-43127112 CCTCCCTAGTTCCTTGGGAGGGG - Intergenic
917745829 1:178006013-178006035 GCATCCTGGTTTGTTGGGAGAGG - Intergenic
918414575 1:184293201-184293223 GCAGCCTTGGGACTTGGTAGAGG + Intergenic
921471652 1:215557153-215557175 GCAGCCTTGCTACTGAGGAGAGG + Intergenic
1067246287 10:44549228-44549250 GGACCTTTGTTACTTAGGCGTGG - Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1077358766 11:2130514-2130536 GCCCCCCTGTTACATGGGGGGGG + Intronic
1083754698 11:64785193-64785215 GCACAGTTGTTACTTGGGGATGG + Intergenic
1085939034 11:81186204-81186226 GCACCATTGTTATTTGGGGATGG - Intergenic
1086586224 11:88455651-88455673 GGACCCTTGTTATTTAGGAGTGG + Intergenic
1091342003 11:134823305-134823327 GCCCCCTTGTCCCTGGGGAGAGG - Intergenic
1098701631 12:73635879-73635901 GTACCCTTGTTACTTGGTCAGGG + Intergenic
1101986055 12:109447962-109447984 CCACGCTTGTGACTGGGGAGGGG + Exonic
1106052973 13:26208697-26208719 GCAACCATGTAACTTGGGAGGGG - Intronic
1109547510 13:63847447-63847469 GCAGCCCTGATACTTGTGAGAGG - Intergenic
1113783959 13:112992548-112992570 GCACGTCTGTTCCTTGGGAGTGG + Intronic
1121435534 14:93916811-93916833 TAATCCTTGTTACTTGGGTGTGG + Intergenic
1125004982 15:34807032-34807054 GCTCCATTGTTACCAGGGAGTGG - Intergenic
1125756695 15:42069877-42069899 GCAGCCTGGGTGCTTGGGAGGGG + Intronic
1126388477 15:48119405-48119427 GCACCCTGATCACTGGGGAGTGG - Intergenic
1129177690 15:73852027-73852049 GCGCCCTTGTTTGTTGGGGGAGG - Intergenic
1129697085 15:77746882-77746904 GCACCCTCCTTCCCTGGGAGTGG - Intronic
1131324588 15:91430070-91430092 GCAGCCTTGTGCCTTGGGACTGG - Intergenic
1141280250 16:82624745-82624767 GCCCCCTTGTTGCTGGGGTGGGG - Intergenic
1143911033 17:10249229-10249251 GCATCATTGCTACTTAGGAGGGG + Intergenic
1147858279 17:43499970-43499992 GCATCATTGCTGCTTGGGAGAGG - Exonic
1148020305 17:44548819-44548841 GCAGCCTTGGAACTTGGCAGGGG + Intergenic
1157201406 18:45662974-45662996 GCACTCTTATCACTTGGGATAGG - Intronic
1159995225 18:74957939-74957961 GCTTCCTTGTTACCTGGCAGAGG + Intronic
1163042843 19:14615307-14615329 GCTCCCTCGTTCCTCGGGAGAGG + Intergenic
1163294507 19:16403624-16403646 TCACCCTTGTTACTTACGTGAGG - Intronic
1163935291 19:20436733-20436755 GCATCCAGATTACTTGGGAGGGG - Intergenic
1168265305 19:55220243-55220265 GCACCCTTGGATCTTGGAAGAGG - Intergenic
932662576 2:73669546-73669568 GCAGCTTTGTTGCTTTGGAGGGG + Intergenic
933675390 2:85051742-85051764 GCAACCTTATTAATTGGGGGTGG - Intronic
936899703 2:117469221-117469243 GGGCCCTTGTCACTTTGGAGGGG + Intergenic
937206130 2:120238265-120238287 GCCCCCATGTTTCCTGGGAGAGG - Intergenic
937231178 2:120398985-120399007 GCACCCTTGCTGATGGGGAGGGG - Intergenic
937328378 2:121005918-121005940 GGACAGTTGTTACTGGGGAGCGG + Intergenic
939225581 2:139359753-139359775 ACATCCTTGTGACTTGGGAGGGG + Intergenic
943763272 2:191632373-191632395 GCATCCTTTTAAGTTGGGAGGGG + Intergenic
945242349 2:207687631-207687653 GAACTCTTGTAACTTTGGAGAGG - Intergenic
948514140 2:238492986-238493008 GCACCATTGATACTAGGGTGGGG + Intergenic
1172701551 20:36856380-36856402 GCACCCTTTATAGATGGGAGTGG + Intronic
1178417191 21:32413201-32413223 ACACCCTTCCTTCTTGGGAGTGG - Intronic
1179894932 21:44356350-44356372 TCACCCTTGTTACTGGAAAGGGG + Intronic
1181130024 22:20725774-20725796 TCATCCCAGTTACTTGGGAGGGG + Intronic
1184366873 22:44057504-44057526 GGGCCCTTGTGACTTGGCAGGGG + Intronic
950489438 3:13294707-13294729 GCACCCCTGTTTGTTGGGAGGGG - Intergenic
952974487 3:38682253-38682275 GCAGCATTGCCACTTGGGAGGGG + Intergenic
953641174 3:44709732-44709754 GAATCCCTGTTACTGGGGAGTGG - Intergenic
954581641 3:51706417-51706439 ATACCCTTTTTACATGGGAGTGG + Intergenic
957008643 3:74980314-74980336 GAACCCTTGAAACTAGGGAGAGG + Intergenic
961661587 3:128471548-128471570 GGAGCCTTGTAACATGGGAGTGG + Intergenic
964271910 3:154965786-154965808 GCCCTCTTGTTGCTTAGGAGAGG - Intergenic
964752524 3:160065457-160065479 GCACCCTTGTCACCCGGGAGTGG - Intergenic
966331889 3:178823823-178823845 TCGCTCTTGTTGCTTGGGAGAGG - Intronic
970215077 4:13750490-13750512 GGACCCAGGTTTCTTGGGAGAGG + Intergenic
970441735 4:16085883-16085905 GCAGCCTTGTGGCTTGGGAAAGG + Intergenic
971047505 4:22821659-22821681 GCAACCTTGGTATTTGGCAGTGG + Intergenic
971177587 4:24294589-24294611 GCAAACTTGTTTTTTGGGAGTGG - Intergenic
977895486 4:102360410-102360432 CCACCCTAGTTACGTGGAAGTGG + Intronic
979960573 4:127015928-127015950 GCACCTTTGTTTCTTTGGAATGG - Intergenic
981896820 4:149811620-149811642 GGACCCTGGATACCTGGGAGTGG - Intergenic
982342292 4:154313176-154313198 GCACCCTTTCCTCTTGGGAGTGG + Intronic
982963700 4:161875230-161875252 GCACTTTTGTTACTTAGGCGTGG - Intronic
984389461 4:179110405-179110427 GCACCCTGATTACATGGGAGAGG - Intergenic
985584937 5:725895-725917 GCACCCTGGATGCTTGGCAGGGG + Intronic
985598442 5:810209-810231 GCACCCTGGATGCTTGGCAGGGG + Intronic
987891052 5:23879228-23879250 GTACCCTTGTGGCTTTGGAGGGG - Intergenic
995839382 5:116429150-116429172 TCAGCCTTGTGACTTGGGATTGG - Intergenic
1001617977 5:173057291-173057313 GCAGCCATGTTAGATGGGAGGGG + Intronic
1004067064 6:12257807-12257829 GCAGCCTTTTTACATGTGAGAGG - Intergenic
1019897398 7:3993207-3993229 GCAACCTTGATATTTGGGAGAGG + Intronic
1038994538 8:32906872-32906894 GCACCTTTGTCTCTTGGGGGTGG + Intergenic
1044412692 8:91901963-91901985 GCTCCCTTGTTTCCTGGGACAGG + Intergenic
1054906999 9:70420577-70420599 GCAACCTTGGAACTTGGGAGGGG - Intergenic
1055785067 9:79863202-79863224 TCACCCTTGTCATGTGGGAGAGG - Intergenic
1057926047 9:99150714-99150736 GCACCCTTGTTACTTGGGAGAGG + Exonic
1058704571 9:107627863-107627885 GCAGCCTTGGCACTGGGGAGAGG - Intergenic
1059981448 9:119776805-119776827 GCACCCTGGCTAATTTGGAGTGG - Intergenic
1060572150 9:124651911-124651933 GCCTCTTTGTTTCTTGGGAGAGG - Intronic
1061493157 9:130957238-130957260 GGACCCTTGTCACCTGGGACTGG + Intergenic
1061756346 9:132815149-132815171 GCACCCTTGTTACACAGCAGAGG + Intronic
1061893066 9:133632946-133632968 GCCCCGTTGTCACTGGGGAGTGG + Intergenic
1062455615 9:136636141-136636163 TAATCCCTGTTACTTGGGAGCGG + Intergenic
1187160020 X:16755645-16755667 AGATCCTTGTAACTTGGGAGTGG - Intronic
1188249547 X:27876092-27876114 GCACCCTTGTTGCCTTTGAGTGG + Intergenic
1189211405 X:39287087-39287109 GCACACATGTAACTTGGCAGGGG - Intergenic
1199357669 X:146880759-146880781 GCCCTTTTGTTACTTGGGTGTGG - Intergenic