ID: 1057928068

View in Genome Browser
Species Human (GRCh38)
Location 9:99170573-99170595
Sequence ATGGGGAAACAGGCTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057928058_1057928068 22 Left 1057928058 9:99170528-99170550 CCAGGGGACTTAGGGATTCCTGG No data
Right 1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG No data
1057928062_1057928068 4 Left 1057928062 9:99170546-99170568 CCTGGGGACAGCCTTCTTACTGT No data
Right 1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG No data
1057928066_1057928068 -7 Left 1057928066 9:99170557-99170579 CCTTCTTACTGTGTAGATGGGGA No data
Right 1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057928068 Original CRISPR ATGGGGAAACAGGCTGAGAA AGG Intergenic
No off target data available for this crispr