ID: 1057930688

View in Genome Browser
Species Human (GRCh38)
Location 9:99190456-99190478
Sequence AAGCCTCCAGATCTTTAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057930681_1057930688 21 Left 1057930681 9:99190412-99190434 CCAGAGCCCATCACAGACTGCCC No data
Right 1057930688 9:99190456-99190478 AAGCCTCCAGATCTTTAGCCTGG No data
1057930685_1057930688 1 Left 1057930685 9:99190432-99190454 CCCATGGTTTCTAGAACAAAGTC No data
Right 1057930688 9:99190456-99190478 AAGCCTCCAGATCTTTAGCCTGG No data
1057930680_1057930688 28 Left 1057930680 9:99190405-99190427 CCTTGGTCCAGAGCCCATCACAG No data
Right 1057930688 9:99190456-99190478 AAGCCTCCAGATCTTTAGCCTGG No data
1057930686_1057930688 0 Left 1057930686 9:99190433-99190455 CCATGGTTTCTAGAACAAAGTCC No data
Right 1057930688 9:99190456-99190478 AAGCCTCCAGATCTTTAGCCTGG No data
1057930684_1057930688 14 Left 1057930684 9:99190419-99190441 CCATCACAGACTGCCCATGGTTT No data
Right 1057930688 9:99190456-99190478 AAGCCTCCAGATCTTTAGCCTGG No data
1057930683_1057930688 15 Left 1057930683 9:99190418-99190440 CCCATCACAGACTGCCCATGGTT No data
Right 1057930688 9:99190456-99190478 AAGCCTCCAGATCTTTAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057930688 Original CRISPR AAGCCTCCAGATCTTTAGCC TGG Intergenic