ID: 1057933163

View in Genome Browser
Species Human (GRCh38)
Location 9:99213376-99213398
Sequence CTTTGGTAGTAGAAGTATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057933159_1057933163 23 Left 1057933159 9:99213330-99213352 CCTTCTCTGTTATTTTTTCAAAC No data
Right 1057933163 9:99213376-99213398 CTTTGGTAGTAGAAGTATTAAGG No data
1057933158_1057933163 24 Left 1057933158 9:99213329-99213351 CCCTTCTCTGTTATTTTTTCAAA No data
Right 1057933163 9:99213376-99213398 CTTTGGTAGTAGAAGTATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057933163 Original CRISPR CTTTGGTAGTAGAAGTATTA AGG Intergenic
No off target data available for this crispr