ID: 1057934785

View in Genome Browser
Species Human (GRCh38)
Location 9:99227907-99227929
Sequence TGCACTCCTTGTCCCACAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 171}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057934785_1057934792 5 Left 1057934785 9:99227907-99227929 CCAGCTGTGGGACAAGGAGTGCA 0: 1
1: 1
2: 1
3: 10
4: 171
Right 1057934792 9:99227935-99227957 CACAACCTCGGCAGGCACCGGGG 0: 1
1: 0
2: 1
3: 8
4: 138
1057934785_1057934796 13 Left 1057934785 9:99227907-99227929 CCAGCTGTGGGACAAGGAGTGCA 0: 1
1: 1
2: 1
3: 10
4: 171
Right 1057934796 9:99227943-99227965 CGGCAGGCACCGGGGGGATGTGG 0: 1
1: 0
2: 0
3: 21
4: 269
1057934785_1057934793 6 Left 1057934785 9:99227907-99227929 CCAGCTGTGGGACAAGGAGTGCA 0: 1
1: 1
2: 1
3: 10
4: 171
Right 1057934793 9:99227936-99227958 ACAACCTCGGCAGGCACCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 46
1057934785_1057934788 -3 Left 1057934785 9:99227907-99227929 CCAGCTGTGGGACAAGGAGTGCA 0: 1
1: 1
2: 1
3: 10
4: 171
Right 1057934788 9:99227927-99227949 GCAGGCCGCACAACCTCGGCAGG 0: 1
1: 1
2: 0
3: 9
4: 70
1057934785_1057934794 7 Left 1057934785 9:99227907-99227929 CCAGCTGTGGGACAAGGAGTGCA 0: 1
1: 1
2: 1
3: 10
4: 171
Right 1057934794 9:99227937-99227959 CAACCTCGGCAGGCACCGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 92
1057934785_1057934790 3 Left 1057934785 9:99227907-99227929 CCAGCTGTGGGACAAGGAGTGCA 0: 1
1: 1
2: 1
3: 10
4: 171
Right 1057934790 9:99227933-99227955 CGCACAACCTCGGCAGGCACCGG 0: 1
1: 0
2: 0
3: 11
4: 102
1057934785_1057934791 4 Left 1057934785 9:99227907-99227929 CCAGCTGTGGGACAAGGAGTGCA 0: 1
1: 1
2: 1
3: 10
4: 171
Right 1057934791 9:99227934-99227956 GCACAACCTCGGCAGGCACCGGG 0: 1
1: 0
2: 1
3: 5
4: 112
1057934785_1057934787 -7 Left 1057934785 9:99227907-99227929 CCAGCTGTGGGACAAGGAGTGCA 0: 1
1: 1
2: 1
3: 10
4: 171
Right 1057934787 9:99227923-99227945 GAGTGCAGGCCGCACAACCTCGG 0: 1
1: 0
2: 1
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057934785 Original CRISPR TGCACTCCTTGTCCCACAGC TGG (reversed) Exonic
900677249 1:3895372-3895394 TGCACGTCTTTTCCCGCAGCAGG + Intronic
906169043 1:43708024-43708046 TTCTTTCCTTTTCCCACAGCAGG - Intronic
906318243 1:44801617-44801639 TGCAGTCCCTGGCCCACATCTGG + Exonic
906722405 1:48018529-48018551 TGCATTCTTTATCCCCCAGCTGG + Intergenic
907426043 1:54379962-54379984 GGCACTCCTGGTCTCACAGTGGG + Intronic
907508883 1:54943727-54943749 TTCACTCCATGTCTCACAGCCGG - Intergenic
908396734 1:63731899-63731921 TCCACATCCTGTCCCACAGCTGG + Intergenic
914932807 1:151949864-151949886 TGCCCTGCTTGTCCCACTGCAGG + Intergenic
915740929 1:158117941-158117963 TGCACTGCTTCTCCCCCAGGGGG + Intergenic
915900108 1:159840661-159840683 TGCACTTCTTGTCCTTCTGCTGG - Intronic
916649514 1:166821778-166821800 TTCACTCCATTTCCCACAGGTGG - Intergenic
1062956616 10:1544387-1544409 TCCACTCCTTGGCCCAGGGCAGG + Intronic
1064134865 10:12741847-12741869 CTCCCTCCTTGTCCCAAAGCAGG - Intronic
1064154922 10:12896144-12896166 TGGGCTCCTTGTACCACAGAGGG + Intergenic
1065159825 10:22908427-22908449 TTGACTCCTTGTCTCACATCCGG + Intergenic
1066068991 10:31786005-31786027 TTCACTCCATGTCCCACTCCAGG - Intergenic
1066459105 10:35597722-35597744 TGCACTCACTGCCCCTCAGCTGG - Intergenic
1067776567 10:49168612-49168634 TGCAGTGCTTGGCCCACAGGAGG + Intronic
1069934000 10:71902587-71902609 TGCCCTCCTGGACACACAGCTGG + Intergenic
1070351699 10:75598964-75598986 TGCATTCCTTGTCCATCAGGTGG + Intronic
1075937205 10:126352555-126352577 TGAACTGCTTGGACCACAGCTGG + Intronic
1077212970 11:1382050-1382072 TTCCCTCCTTGTCCCTCAGTGGG + Intergenic
1078613292 11:12840901-12840923 TGCCCTCCCTGTCCTTCAGCTGG + Intronic
1082066537 11:47905476-47905498 TGCGCTCCTTGTCCCACAGCTGG + Intergenic
1083660717 11:64250737-64250759 TGCAGTGCCTGGCCCACAGCAGG - Intergenic
1083948983 11:65943395-65943417 TGCCATCCTTCTCCCACACCTGG - Intergenic
1084169153 11:67392176-67392198 TCCACTCCCTGTCCCGCATCGGG + Exonic
1088430882 11:109757515-109757537 TGCACTCCTTTTCCCTAAGCCGG + Intergenic
1089156938 11:116409759-116409781 TGCAATGCTTGACACACAGCTGG - Intergenic
1089797838 11:120997380-120997402 TTCCCTCCTTGTCCCAGAGCTGG - Intergenic
1089969633 11:122682429-122682451 GTCACTCCTTGCCCCACAACAGG - Intronic
1090534515 11:127625953-127625975 GGCACTCCTTGTCCAAAGGCAGG - Intergenic
1091410078 12:233437-233459 TGCACTCCCTCTACTACAGCGGG - Intronic
1093462810 12:19421679-19421701 TGCAAACCTTGTCACATAGCAGG + Intronic
1097392544 12:59033360-59033382 TGCACTCCCACTCCCATAGCTGG - Intergenic
1097637649 12:62142256-62142278 TGCTCTGCCTGGCCCACAGCAGG + Intronic
1099198266 12:79645546-79645568 TGGACTCCTTAGGCCACAGCTGG - Intronic
1100107666 12:91196373-91196395 TGGAATTCTTGTCCCAAAGCAGG - Intergenic
1101200447 12:102430082-102430104 TGCTCTCTTTGTCTCACATCTGG + Intronic
1103927429 12:124430688-124430710 TGCTCTCCTTGGCCCGCCGCCGG + Exonic
1105418438 13:20232471-20232493 TGCACTCCTTGCTCCTCAGGGGG - Intergenic
1105672674 13:22637020-22637042 TCCAGCCCTTGTCCCCCAGCTGG + Intergenic
1106124548 13:26889576-26889598 TTCATTCCCTGTCCCACACCAGG - Intergenic
1106297934 13:28435106-28435128 TGCCTTCCTTGTGACACAGCAGG - Intronic
1107319089 13:39166745-39166767 TGCACTCATTGTGCCAGAACAGG + Intergenic
1108092288 13:46861454-46861476 TTTACTCCTTTGCCCACAGCTGG - Intronic
1111607919 13:90564305-90564327 TGCACTCGTTTGCCCACACCTGG + Intergenic
1112954505 13:105041761-105041783 TGAACTCCATGTCTCACATCCGG + Intergenic
1113098959 13:106696363-106696385 AGCACTCTCTATCCCACAGCTGG + Intergenic
1122070718 14:99203917-99203939 GGCACTCCTTGGCTCAGAGCGGG - Intronic
1122379476 14:101291587-101291609 TACACTCCTCATGCCACAGCTGG + Intergenic
1124399607 15:29336768-29336790 AGCTCTCCCTGGCCCACAGCTGG + Intronic
1125534068 15:40432885-40432907 TGTACTCCTTGTCTCCCATCTGG - Intronic
1129055959 15:72820695-72820717 AGCACTGGTTTTCCCACAGCAGG - Intergenic
1129469028 15:75740018-75740040 TGCTCTCCATGGACCACAGCTGG - Intergenic
1129644957 15:77420886-77420908 CGCACTCGTCGTCTCACAGCTGG - Exonic
1130869065 15:87956012-87956034 TCCTCTCCTTGTCCCACCACGGG - Intronic
1132419130 15:101650335-101650357 TGCTCACCAGGTCCCACAGCTGG - Intronic
1132830994 16:1928222-1928244 TCCTCTCCTTCCCCCACAGCAGG - Intergenic
1132856446 16:2047228-2047250 TGCAGTGCTTGGCCCCCAGCAGG + Intronic
1132884352 16:2176045-2176067 TGGACTCAATGTCCCACACCTGG - Exonic
1133008531 16:2897708-2897730 TCCCCTCCTGGCCCCACAGCAGG + Intronic
1135687312 16:24508144-24508166 CCCACTCCTTGTTCCTCAGCAGG - Intergenic
1136131582 16:28225298-28225320 TGCCCTCCTTGTCCCTCTGATGG - Intergenic
1144168423 17:12634802-12634824 TGCATGCCTTGTCCCACTTCTGG - Intergenic
1144997568 17:19281034-19281056 TGCACTCCTTCTCCCACACCTGG - Intronic
1146258853 17:31408774-31408796 TGTTCTCCTTGACTCACAGCTGG - Intronic
1147733490 17:42618803-42618825 AGCAGTCCTTGTCTCTCAGCGGG - Intergenic
1147914178 17:43876951-43876973 AGCTCTCCATGGCCCACAGCAGG - Intronic
1147953125 17:44118000-44118022 TGCACACCTAGTCCCATGGCAGG - Intronic
1148072233 17:44915159-44915181 TGGGCTCCTTGGCCCGCAGCTGG + Exonic
1150225912 17:63524317-63524339 TGCACTCCTCAGCCCCCAGCAGG - Exonic
1151802700 17:76387136-76387158 TGCACACCTTGTGCCACTGGAGG + Exonic
1152561251 17:81079875-81079897 GGCACACCCTGTCCCTCAGCAGG + Intronic
1153121719 18:1736207-1736229 TGGAATGCTTGTCCCACAGTAGG - Intergenic
1159394828 18:67842754-67842776 TTCACACCTTGTCTCACTGCAGG + Intergenic
1163561128 19:18020313-18020335 GTCACCCCTTGTCCCCCAGCTGG - Intergenic
1164626083 19:29728963-29728985 TGGACTCCTTTTCCCATATCAGG + Intergenic
1168117131 19:54229276-54229298 TGCACTCCTTGTTCCATGGTTGG - Intronic
925378915 2:3409951-3409973 CCCACTCCGTGTCCCCCAGCAGG + Intronic
926156574 2:10458039-10458061 AGAACTCCTGGTTCCACAGCTGG - Intergenic
926551148 2:14302200-14302222 TGCAATCCTTGTACCACTTCTGG - Intergenic
926636157 2:15181957-15181979 TGCAGTCCTTGCCCTCCAGCAGG + Intronic
927681225 2:25140695-25140717 TTCACACCTTGTCCCAAACCTGG - Intronic
929872880 2:45773309-45773331 TCCACTCAATGTCACACAGCTGG - Intronic
931770047 2:65489498-65489520 TGCACTGCTGCTCACACAGCAGG - Intergenic
932775843 2:74527936-74527958 TGCACTCCGTGTACAACAGGTGG - Exonic
933481997 2:82869720-82869742 TTGACTACTTGTCCCACATCCGG + Intergenic
934025734 2:88000281-88000303 TGGCTTCCTTGTCCCACAGGTGG - Intergenic
934952182 2:98584352-98584374 TGCACTCCCACTTCCACAGCAGG + Intronic
936043621 2:109169203-109169225 AGCACTGTTTGTCCCATAGCTGG - Intronic
936286157 2:111182916-111182938 TGCACTCCTGGACCCACTGAAGG + Intergenic
936996292 2:118417457-118417479 CCCACCCCTTGTCCCACAGTGGG + Intergenic
937555644 2:123152048-123152070 TTCACTCCCTGTCCCAGAGCAGG - Intergenic
948060922 2:235042854-235042876 ACCACTCCTTGGTCCACAGCTGG - Exonic
1169198230 20:3694621-3694643 TGCATTCCTTCCCCCACACCTGG + Intronic
1170180551 20:13525188-13525210 TGCATTTCTTGTCCCAGAGTAGG - Intronic
1170261626 20:14414757-14414779 TGCACTGCTTTTCCCTCTGCTGG + Intronic
1171187847 20:23136288-23136310 AGCACTCTCTGTCCCACAGTGGG - Intergenic
1171331972 20:24348377-24348399 TGCACTCCCAATGCCACAGCAGG + Intergenic
1171389312 20:24790968-24790990 TGCACTACAGATCCCACAGCAGG - Intergenic
1172404888 20:34680623-34680645 TACACTACTTGGCACACAGCAGG - Intergenic
1173593608 20:44244555-44244577 GGCACTCCTGGTCCAACTGCTGG + Intergenic
1174773692 20:53324274-53324296 AGCACTCATGGTCCAACAGCAGG + Intronic
1174862800 20:54107757-54107779 CACACTCCTTGGCCCACAGAGGG + Intergenic
1175264246 20:57692930-57692952 GGGACACCTTGACCCACAGCAGG - Intronic
1175369804 20:58480632-58480654 TGCACTTCCTTTCCCTCAGCAGG - Intronic
1175629476 20:60522571-60522593 TGGCTTCCTTGTCCCACAGCTGG + Intergenic
1177641035 21:23845306-23845328 TTCACTCCATGTCTCACATCTGG + Intergenic
1181007691 22:20021735-20021757 GGCAGTCCTTGCCCCACCGCTGG + Intronic
1181324571 22:22034769-22034791 TGGCCTCCTTGTCCCAGAGTGGG + Intergenic
1182618545 22:31604973-31604995 TGCATTCCTTGTTCCCCAGCTGG - Intronic
1182972573 22:34591575-34591597 TGCCATTCTTGTCTCACAGCAGG + Intergenic
1185368870 22:50449889-50449911 TGCACTGCTTGTCTGACATCTGG - Intronic
950569196 3:13789531-13789553 TGCCCTCCTTGTTCTACAGATGG - Intergenic
950725195 3:14912676-14912698 TGGACTCCAAGACCCACAGCAGG - Intronic
952871571 3:37905596-37905618 CTCCCTCCTTGTGCCACAGCTGG + Intronic
955756877 3:62233698-62233720 TCATCTCCCTGTCCCACAGCAGG + Intronic
959916231 3:111819507-111819529 TGTACTCATTGTCCCCCAGGTGG - Intronic
961075729 3:123980031-123980053 TGCACGCCTTTTCCCACTCCCGG - Intronic
961794892 3:129402424-129402446 TGCACTCCTGGCACAACAGCTGG - Intronic
965203933 3:165696341-165696363 TGCTCTCCTGGTTCAACAGCTGG - Intergenic
968025874 3:195442499-195442521 TGCACCCCATTTCCCCCAGCGGG + Intronic
968978602 4:3834782-3834804 TGCACCCCTTGCCCTGCAGCTGG - Intergenic
969318425 4:6395845-6395867 TGCAGGCCTTGTTCCCCAGCTGG + Intronic
971161250 4:24136321-24136343 TACAATCCATGTCCCACAGTTGG + Intergenic
972879569 4:43407120-43407142 TTGACTCCTTGTCTCACATCCGG - Intergenic
973133391 4:46676146-46676168 TTCTCCTCTTGTCCCACAGCTGG + Intergenic
983877833 4:172897298-172897320 TCCAGTCTCTGTCCCACAGCAGG - Intronic
984475918 4:180234885-180234907 CTTCCTCCTTGTCCCACAGCTGG + Intergenic
984611982 4:181851330-181851352 AGCACTCCATGTCCCAAAGTCGG + Intergenic
985375916 4:189338588-189338610 TACACGCCCTGTCCAACAGCTGG - Intergenic
993016936 5:82544812-82544834 TTGACTCCATGTCCCACATCAGG - Intergenic
995806458 5:116057795-116057817 TGCACCCTTTGTCCCTAAGCAGG - Intronic
997259823 5:132457248-132457270 TGCACTGCCCCTCCCACAGCAGG + Intronic
998159502 5:139805432-139805454 TGCAATGCTTGGCACACAGCAGG - Intronic
999627504 5:153536030-153536052 GGCACTCCTTGTTCCACACCTGG + Intronic
1001114315 5:168926132-168926154 TGCACACCTTTCCCCACAGTTGG - Intronic
1006532848 6:34671860-34671882 TGCTCTACTTTTCCCACTGCTGG - Intronic
1006611107 6:35295125-35295147 TGCACCCCCTTCCCCACAGCTGG + Exonic
1007401359 6:41604359-41604381 TGCATTCCAGGTCCCAGAGCAGG - Intergenic
1010434521 6:75813988-75814010 TGCACTCCTGGCCGCCCAGCTGG + Intronic
1010879552 6:81151015-81151037 TGCACTCACTTTCCCAAAGCTGG - Intergenic
1012194117 6:96317850-96317872 TTCACTCCATGTCTCACATCAGG + Intergenic
1013955454 6:115835440-115835462 TAAACTGCTTGTCCCAGAGCAGG + Intergenic
1018861297 6:167712558-167712580 TGCTCTCCTTGCCTCAGAGCCGG + Intergenic
1019181513 6:170190097-170190119 TGCCCTGCTTGGCCCACACCTGG + Intergenic
1022482431 7:30752747-30752769 AGCAATCCTTGTCCCAGGGCAGG - Intronic
1024958857 7:54954374-54954396 TCCCCTCCTTGCCCCACTGCAGG - Intergenic
1025615770 7:63114682-63114704 TGCACACCCTGTTCCACATCTGG - Intergenic
1026974602 7:74489740-74489762 GGCACTCCTTTTCCCCTAGCTGG - Intronic
1028739073 7:94251197-94251219 TTCACTGCTTGTGACACAGCAGG + Intergenic
1031959948 7:127979963-127979985 TGCCATTCTTGACCCACAGCTGG + Intronic
1033584289 7:142762649-142762671 TGAAGACCTTCTCCCACAGCTGG - Intronic
1034070816 7:148183090-148183112 TCCACTGCTTCCCCCACAGCAGG - Intronic
1034206332 7:149319010-149319032 TGGCTTCCTTGTCCCTCAGCTGG + Intergenic
1035246041 7:157562397-157562419 GTCACTCCTTCCCCCACAGCAGG - Intronic
1035781006 8:2228576-2228598 TCAACTCCTTTTCCCAGAGCTGG + Intergenic
1036744100 8:11391712-11391734 TGCCATCCTTCTCCCACTGCAGG - Intronic
1042882699 8:73511579-73511601 TGCTGTCCCTGTCCCACATCTGG - Intronic
1044182585 8:89214154-89214176 TGCCCTCCTTTTCACAGAGCTGG + Intergenic
1048449767 8:134523210-134523232 TGCTTTCCCTGTCCCACGGCTGG + Intronic
1048998519 8:139809535-139809557 TTCAGTCTCTGTCCCACAGCAGG + Intronic
1049401432 8:142429245-142429267 AGCTCTCCTTGTCCCCAAGCAGG - Intergenic
1049825848 8:144667307-144667329 TGCACTCCTTCCCCCACAAGTGG + Intergenic
1055439281 9:76322866-76322888 TGGCCTCCTTGTCCCAAGGCAGG + Intronic
1057032886 9:91790755-91790777 TCCACATCTTGTCCCACTGCAGG - Intronic
1057839534 9:98474635-98474657 CGCACCCCTTGGCCTACAGCAGG + Intronic
1057934785 9:99227907-99227929 TGCACTCCTTGTCCCACAGCTGG - Exonic
1060212890 9:121721257-121721279 TGGGGTCCTGGTCCCACAGCTGG - Intronic
1061518570 9:131103947-131103969 TGCCCTCCTTGTTCAATAGCTGG - Intronic
1061648456 9:132026249-132026271 CTCACTCCTGGTCCCAAAGCAGG - Intronic
1061876159 9:133545194-133545216 TGCACCCCTTGGGCCACAGTGGG + Intronic
1062176204 9:135164420-135164442 TTCACTCAGTGTCCCAGAGCAGG + Intergenic
1185816430 X:3160322-3160344 TGCACTCTTTGTACCTCAGAAGG + Intergenic
1189418333 X:40833743-40833765 TGCATTCCTTGTCCCACAATAGG - Intergenic
1191117200 X:56864656-56864678 TGCACTCAATATCCCATAGCAGG + Intergenic
1194220527 X:91183715-91183737 TTCACTCCATGTCTCACATCTGG - Intergenic
1196736919 X:118988357-118988379 TCCAATCCTTGTTCCCCAGCTGG - Intronic
1197691224 X:129503101-129503123 TGCCCTCCTTCTCCCTCATCAGG - Intronic
1199684688 X:150255651-150255673 TAGACTCCTTGTTCCACAGCTGG - Intergenic
1200065310 X:153501933-153501955 AGCCCTCGTTGCCCCACAGCTGG + Intronic
1200120279 X:153786944-153786966 CCCCCTCCTTGTCCCGCAGCTGG - Exonic
1200841161 Y:7783041-7783063 TGCACTCCTAGGCCCAAGGCAGG + Intergenic