ID: 1057935782

View in Genome Browser
Species Human (GRCh38)
Location 9:99237634-99237656
Sequence GCCACCAACAAAAAAACCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057935776_1057935782 3 Left 1057935776 9:99237608-99237630 CCAGGCAGAAGAGGCCCATGTGG No data
Right 1057935782 9:99237634-99237656 GCCACCAACAAAAAAACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057935782 Original CRISPR GCCACCAACAAAAAAACCTT GGG Intergenic
No off target data available for this crispr