ID: 1057937899

View in Genome Browser
Species Human (GRCh38)
Location 9:99256336-99256358
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057937899_1057937901 5 Left 1057937899 9:99256336-99256358 CCTCCAGGGATGTGGTGATATTG No data
Right 1057937901 9:99256364-99256386 ATTCCCCTGAGTTTCTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057937899 Original CRISPR CAATATCACCACATCCCTGG AGG (reversed) Intergenic
No off target data available for this crispr