ID: 1057941469

View in Genome Browser
Species Human (GRCh38)
Location 9:99288932-99288954
Sequence CAGGAGCTGGTGGGCTTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057941461_1057941469 11 Left 1057941461 9:99288898-99288920 CCAGGGATCAGGGGAGCTGAAAC No data
Right 1057941469 9:99288932-99288954 CAGGAGCTGGTGGGCTTCGGGGG No data
1057941460_1057941469 12 Left 1057941460 9:99288897-99288919 CCCAGGGATCAGGGGAGCTGAAA No data
Right 1057941469 9:99288932-99288954 CAGGAGCTGGTGGGCTTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057941469 Original CRISPR CAGGAGCTGGTGGGCTTCGG GGG Intergenic
No off target data available for this crispr