ID: 1057941570

View in Genome Browser
Species Human (GRCh38)
Location 9:99289625-99289647
Sequence CTCTCAGCCCCATCCTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057941563_1057941570 1 Left 1057941563 9:99289601-99289623 CCTGGTCCAGGAACTCCTGCTTT No data
Right 1057941570 9:99289625-99289647 CTCTCAGCCCCATCCTGGAGGGG No data
1057941564_1057941570 -5 Left 1057941564 9:99289607-99289629 CCAGGAACTCCTGCTTTCCTCTC No data
Right 1057941570 9:99289625-99289647 CTCTCAGCCCCATCCTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057941570 Original CRISPR CTCTCAGCCCCATCCTGGAG GGG Intergenic
No off target data available for this crispr