ID: 1057943653

View in Genome Browser
Species Human (GRCh38)
Location 9:99306205-99306227
Sequence CAGCTCGGACAGCTTGGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057943653_1057943661 5 Left 1057943653 9:99306205-99306227 CCAACGCCAAGCTGTCCGAGCTG No data
Right 1057943661 9:99306233-99306255 CGCCCTGCAGCGGGCCAAGCAGG 0: 8
1: 13
2: 16
3: 28
4: 136
1057943653_1057943664 14 Left 1057943653 9:99306205-99306227 CCAACGCCAAGCTGTCCGAGCTG No data
Right 1057943664 9:99306242-99306264 GCGGGCCAAGCAGGACATGATGG 0: 1
1: 0
2: 0
3: 11
4: 125
1057943653_1057943658 -5 Left 1057943653 9:99306205-99306227 CCAACGCCAAGCTGTCCGAGCTG No data
Right 1057943658 9:99306223-99306245 AGCTGGAGGCCGCCCTGCAGCGG 0: 12
1: 14
2: 7
3: 33
4: 301
1057943653_1057943666 16 Left 1057943653 9:99306205-99306227 CCAACGCCAAGCTGTCCGAGCTG No data
Right 1057943666 9:99306244-99306266 GGGCCAAGCAGGACATGATGGGG 0: 1
1: 1
2: 10
3: 25
4: 224
1057943653_1057943659 -4 Left 1057943653 9:99306205-99306227 CCAACGCCAAGCTGTCCGAGCTG No data
Right 1057943659 9:99306224-99306246 GCTGGAGGCCGCCCTGCAGCGGG 0: 12
1: 16
2: 20
3: 49
4: 391
1057943653_1057943665 15 Left 1057943653 9:99306205-99306227 CCAACGCCAAGCTGTCCGAGCTG No data
Right 1057943665 9:99306243-99306265 CGGGCCAAGCAGGACATGATGGG 0: 1
1: 0
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057943653 Original CRISPR CAGCTCGGACAGCTTGGCGT TGG (reversed) Intergenic
No off target data available for this crispr