ID: 1057949551

View in Genome Browser
Species Human (GRCh38)
Location 9:99359012-99359034
Sequence TTCTTGCCTGCTCAGCAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057949551_1057949557 29 Left 1057949551 9:99359012-99359034 CCGCCCTGCTGAGCAGGCAAGAA No data
Right 1057949557 9:99359064-99359086 CAAGAGGACCCAGATGACCCTGG No data
1057949551_1057949555 6 Left 1057949551 9:99359012-99359034 CCGCCCTGCTGAGCAGGCAAGAA No data
Right 1057949555 9:99359041-99359063 TCAGGTGATGAACAAGCACAAGG No data
1057949551_1057949556 13 Left 1057949551 9:99359012-99359034 CCGCCCTGCTGAGCAGGCAAGAA No data
Right 1057949556 9:99359048-99359070 ATGAACAAGCACAAGGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057949551 Original CRISPR TTCTTGCCTGCTCAGCAGGG CGG (reversed) Intergenic
No off target data available for this crispr