ID: 1057950141

View in Genome Browser
Species Human (GRCh38)
Location 9:99363357-99363379
Sequence CAGCCGGGCTGCCGTAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057950132_1057950141 20 Left 1057950132 9:99363314-99363336 CCTTTTGACAGCTGTGGGAGGGG No data
Right 1057950141 9:99363357-99363379 CAGCCGGGCTGCCGTAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057950141 Original CRISPR CAGCCGGGCTGCCGTAGGGC TGG Intergenic