ID: 1057950394

View in Genome Browser
Species Human (GRCh38)
Location 9:99365220-99365242
Sequence GCTGATTGACTAGCTTAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057950394_1057950401 7 Left 1057950394 9:99365220-99365242 CCAGTCTAAGCTAGTCAATCAGC No data
Right 1057950401 9:99365250-99365272 GCCCAAAACTGATGGGATACGGG No data
1057950394_1057950396 -1 Left 1057950394 9:99365220-99365242 CCAGTCTAAGCTAGTCAATCAGC No data
Right 1057950396 9:99365242-99365264 CCCCATTTGCCCAAAACTGATGG No data
1057950394_1057950400 6 Left 1057950394 9:99365220-99365242 CCAGTCTAAGCTAGTCAATCAGC No data
Right 1057950400 9:99365249-99365271 TGCCCAAAACTGATGGGATACGG No data
1057950394_1057950398 0 Left 1057950394 9:99365220-99365242 CCAGTCTAAGCTAGTCAATCAGC No data
Right 1057950398 9:99365243-99365265 CCCATTTGCCCAAAACTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057950394 Original CRISPR GCTGATTGACTAGCTTAGAC TGG (reversed) Intergenic
No off target data available for this crispr