ID: 1057950974

View in Genome Browser
Species Human (GRCh38)
Location 9:99368879-99368901
Sequence ACACCGCAGGAAGTTTTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057950970_1057950974 6 Left 1057950970 9:99368850-99368872 CCTGTGTGCAGCAGGCTGCTCGC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1057950974 9:99368879-99368901 ACACCGCAGGAAGTTTTCAAAGG 0: 1
1: 0
2: 0
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057950974 Original CRISPR ACACCGCAGGAAGTTTTCAA AGG Intergenic
901762778 1:11481330-11481352 CCTCCCCAGGAAGTTTTCTAGGG + Intronic
906849192 1:49229673-49229695 ACACCTCAGGCAATCTTCAAAGG - Intronic
909005343 1:70269128-70269150 ACACAGGAGGAAGTTTTACAGGG + Intronic
919589068 1:199476968-199476990 TCACTGCAGAAAGTGTTCAAGGG - Intergenic
922036453 1:221852926-221852948 ACACCATGGGAAGTTTTCACTGG + Intergenic
924078697 1:240369522-240369544 ACACCAAAGCAACTTTTCAAGGG - Intronic
1070739750 10:78894970-78894992 GGAGAGCAGGAAGTTTTCAAAGG - Intergenic
1073619452 10:105031589-105031611 ACACGGCAGCAAGTTCTCCAGGG - Intronic
1075818265 10:125283303-125283325 ACACCAGAGGAAGTTTGCATTGG - Intergenic
1076751309 10:132544807-132544829 ACACCGCCGGCCGTTCTCAAAGG - Intronic
1078728529 11:13954875-13954897 ACACAGGAGGATGTTTACAATGG - Intergenic
1080801676 11:35616145-35616167 ACTCCCCAGGAAGTTTACAATGG + Intergenic
1085376637 11:76068509-76068531 ACACTGGAGGCAGTTTTAAAAGG + Intronic
1087570440 11:99920677-99920699 ACACAGCAAGAAGTTGTCTATGG - Intronic
1088291605 11:108244300-108244322 ACACTACGTGAAGTTTTCAAGGG + Intronic
1091888147 12:4031537-4031559 ACACCGAAGGAATTTTTCCCAGG - Intergenic
1091928516 12:4375345-4375367 CCACCGCCGGATGTTTTCTAGGG - Intronic
1094845525 12:34359768-34359790 AAACCGCAGGAAGGCTTGAAAGG - Intergenic
1094854770 12:34398011-34398033 AGGCGGCAGGAAGTCTTCAAAGG + Intergenic
1096713064 12:53471976-53471998 AAACTGCAGTAAGTTTTCAAGGG + Intronic
1109936922 13:69299229-69299251 ACACTGCAGGGAGTTATCAAGGG - Intergenic
1110225118 13:73111500-73111522 ACACAGGAGGAAGTTTTTATTGG + Intergenic
1115246906 14:31304917-31304939 ACACTGCAGGAAGTTCGGAAAGG + Exonic
1116781588 14:49243114-49243136 ATATCTCAGTAAGTTTTCAATGG - Intergenic
1123674510 15:22695849-22695871 ACATCTCATGAAGTTTTTAAAGG - Intergenic
1124326522 15:28768840-28768862 ACATCTCATGAAGTTTTTAAAGG - Intergenic
1131443399 15:92475808-92475830 AAACAGCAGCAAGTATTCAAAGG - Intronic
1134228359 16:12409805-12409827 ACACTGAAGGTATTTTTCAAAGG - Intronic
1134685156 16:16153400-16153422 ACACAGCATGATGTCTTCAAGGG - Intronic
1139825892 16:69756836-69756858 CCACAGCAGGAAGGATTCAAGGG - Intergenic
1142275054 16:89114022-89114044 ACAGCGCAGGAACTTTGCAGGGG + Intronic
1148090814 17:45021647-45021669 ACACAGCTGGGAGATTTCAAGGG + Intergenic
1149062406 17:52438365-52438387 ACAATGCAGCATGTTTTCAAAGG - Intergenic
1150715953 17:67572772-67572794 TGACAGCAGGAAGTTTTCCAGGG + Intronic
1153508227 18:5825489-5825511 AGACAGCAGCAAGTTGTCAATGG + Intergenic
1156319233 18:36002928-36002950 ACACATTAGGAAGTTTTAAATGG + Intronic
1156690497 18:39701309-39701331 ACAGCTGAGGATGTTTTCAAAGG - Intergenic
1163993642 19:21022629-21022651 ACACCCCATAAAGTTTCCAAAGG - Intronic
1167471140 19:49677156-49677178 ACCCCGCTGGAAGATTTCATTGG - Intronic
926667402 2:15541125-15541147 ACAGAGCAGCCAGTTTTCAAGGG - Intronic
927878599 2:26675004-26675026 ACACAGCAGGAATTTTCCACTGG + Intergenic
929969590 2:46562621-46562643 ACACAGCAGGCAGGTTTCAGTGG - Intronic
932069499 2:68604329-68604351 ACACAGCATGATGTCTTCAAGGG - Intronic
933162114 2:79036897-79036919 ACACAGCAGGAAGTTTGTTATGG + Intergenic
933297492 2:80506898-80506920 ACAGAGAAGGAAGTTTGCAAAGG - Intronic
937515896 2:122655188-122655210 ACAACGGATGAAGTGTTCAATGG + Intergenic
940129442 2:150364264-150364286 ACACCGCAGGAAGCTGTCACAGG + Intergenic
941480900 2:166010957-166010979 AAACCTCAGGAAGTTTTAAAGGG + Intronic
945067420 2:205958881-205958903 ACATAGCATGATGTTTTCAAGGG - Intergenic
947252909 2:228128211-228128233 ACACAGCAGCAAGTTTTGAGAGG - Intronic
947333773 2:229058319-229058341 TCACAGCAGGAACTTTCCAATGG + Intronic
948562576 2:238864455-238864477 ACAGAGCAGGAAGGTTTGAATGG + Intronic
1168813606 20:721913-721935 CCACCGCAGGAAGTTCGGAAAGG - Intergenic
1170915021 20:20614382-20614404 AAAACTCAGGGAGTTTTCAAAGG + Intronic
1177110522 21:17022072-17022094 ACAGTCCAGGAAGATTTCAAAGG + Intergenic
1177473309 21:21586189-21586211 ACAACGGAGGAAGTTTAAAAAGG - Intergenic
1179450571 21:41465843-41465865 ACTCAGCAGGAAGATCTCAATGG + Exonic
1181265952 22:21630612-21630634 ACAACCCAGAAAGTTTACAATGG - Intergenic
1181624661 22:24115039-24115061 ACACTGTAGGAAGTTTGGAATGG + Intronic
953792219 3:45956455-45956477 ACACCCCAGGAACTTTGCATGGG - Intronic
956571776 3:70704358-70704380 ACAACACAGGTAGTCTTCAAAGG + Intergenic
963086786 3:141444542-141444564 ACACAGCAGCCAGTTTTCATCGG + Exonic
966373114 3:179268831-179268853 GCAGGGCAGGAAGTTTTTAAAGG - Intergenic
966399925 3:179537731-179537753 ACACCATAGGCATTTTTCAATGG + Intergenic
982612496 4:157593591-157593613 ACTCCTGAGGATGTTTTCAAAGG - Intergenic
993106342 5:83604999-83605021 AAACTGCAGACAGTTTTCAAAGG - Intergenic
993595928 5:89855453-89855475 ACACTGCAGGTAGTTTTTTAGGG - Intergenic
995623449 5:114053099-114053121 ACACTCCATGAAGTTTTCCAAGG - Intergenic
1000046413 5:157525397-157525419 ACACAGAAGGAAGCTTTTAATGG + Intronic
1000730995 5:164833899-164833921 ACATCGCTTTAAGTTTTCAAAGG - Intergenic
1001960827 5:175879606-175879628 ACACAGCAGGAAGTTCTGATGGG + Intronic
1006779007 6:36619263-36619285 ACAAAGCAGGATGTTTTCAGTGG - Intergenic
1007366107 6:41394406-41394428 AAAACTCAGGAAGTTTTGAATGG + Intergenic
1010212090 6:73369967-73369989 GCAGCGCAGGAAGTGTCCAATGG - Intronic
1012201308 6:96409912-96409934 AAACCACAGCAAGTTTTCAGAGG + Intergenic
1015827302 6:137328114-137328136 AGACAGCAGGATGTATTCAAAGG - Intergenic
1016035127 6:139376141-139376163 TCGCAGCAGGAAGTCTTCAATGG - Intergenic
1018306607 6:162463556-162463578 ACACAGCAGGATGTGTTAAAAGG - Intronic
1019229660 6:170548739-170548761 ACACAGCAGGAAATTTTTCATGG + Intronic
1019466497 7:1192451-1192473 AAGCCACAGGAAGTTTTAAACGG - Intergenic
1023055386 7:36286137-36286159 ACAACGCAGGCTGTTTTTAAGGG + Intronic
1026416463 7:70186287-70186309 ACACAGGAGGCAGTTTTCATTGG + Intronic
1026864749 7:73816652-73816674 GAACCTCAGGAAGTTTCCAAAGG + Intronic
1038445451 8:27600786-27600808 ACACCGCAGAAAGTTCTCTCTGG + Intronic
1038631656 8:29250908-29250930 ATACAGCAAGAAGTTTTCAGTGG - Intronic
1039101537 8:33946981-33947003 ACTCAGCAGAAAGTTGTCAAAGG - Intergenic
1041240893 8:55848213-55848235 AGACCATAGGAAGATTTCAAAGG + Intergenic
1041628943 8:60063094-60063116 ACATATCAGGAAGTATTCAATGG + Intergenic
1048600729 8:135916319-135916341 ACACCGCAGGAAATGTGCCATGG + Intergenic
1048638180 8:136322871-136322893 AAAAGACAGGAAGTTTTCAAAGG - Intergenic
1055070546 9:72161551-72161573 AGACCTCATGAAGTTCTCAAAGG + Intronic
1057950974 9:99368879-99368901 ACACCGCAGGAAGTTTTCAAAGG + Intergenic
1186672948 X:11785407-11785429 ACATCTCAGCAAGTTTCCAAGGG - Intergenic
1186768827 X:12797407-12797429 AAACCTCAGGCATTTTTCAATGG - Intronic
1187918824 X:24181173-24181195 AAATCTCAAGAAGTTTTCAAAGG - Intronic
1188684626 X:33054611-33054633 AAACCGCAGAAGGTTTTCTAGGG + Intronic
1192269211 X:69563063-69563085 ACACCTCTGGAAGAATTCAAAGG + Intergenic
1197764975 X:130054376-130054398 ACACCGGGGGAAGGTTTCACAGG + Intronic
1198010825 X:132551893-132551915 AGACCTCAGGAAGCTTACAATGG - Intergenic
1199411253 X:147526383-147526405 ACATCACAGCAATTTTTCAAAGG + Intergenic
1199519034 X:148714073-148714095 ACACTGCAGGAAGTACTCCAGGG - Intronic