ID: 1057953120

View in Genome Browser
Species Human (GRCh38)
Location 9:99385801-99385823
Sequence GGTCCCCAGGGTCCCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057953120_1057953131 5 Left 1057953120 9:99385801-99385823 CCAGCCTGGGGACCCTGGGGACC No data
Right 1057953131 9:99385829-99385851 AGGGAGGCTTCAAACTCAGATGG No data
1057953120_1057953132 9 Left 1057953120 9:99385801-99385823 CCAGCCTGGGGACCCTGGGGACC No data
Right 1057953132 9:99385833-99385855 AGGCTTCAAACTCAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057953120 Original CRISPR GGTCCCCAGGGTCCCCAGGC TGG (reversed) Intergenic
No off target data available for this crispr