ID: 1057956258

View in Genome Browser
Species Human (GRCh38)
Location 9:99410485-99410507
Sequence CAGGTACATCAGTCTGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057956258_1057956262 -1 Left 1057956258 9:99410485-99410507 CCCAACTCAGACTGATGTACCTG No data
Right 1057956262 9:99410507-99410529 GCATAAGAAAAGGAATCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057956258 Original CRISPR CAGGTACATCAGTCTGAGTT GGG (reversed) Intergenic
No off target data available for this crispr