ID: 1057958552

View in Genome Browser
Species Human (GRCh38)
Location 9:99432944-99432966
Sequence ACCCAAAGCAGAAGGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057958552_1057958559 1 Left 1057958552 9:99432944-99432966 CCCACCCCCCTTCTGCTTTGGGT No data
Right 1057958559 9:99432968-99432990 TTTTATTTAATTAAATCATCAGG No data
1057958552_1057958560 22 Left 1057958552 9:99432944-99432966 CCCACCCCCCTTCTGCTTTGGGT No data
Right 1057958560 9:99432989-99433011 GGTGCCCAGTCACCCAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057958552 Original CRISPR ACCCAAAGCAGAAGGGGGGT GGG (reversed) Intergenic