ID: 1057958553

View in Genome Browser
Species Human (GRCh38)
Location 9:99432945-99432967
Sequence CACCCAAAGCAGAAGGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057958553_1057958559 0 Left 1057958553 9:99432945-99432967 CCACCCCCCTTCTGCTTTGGGTG No data
Right 1057958559 9:99432968-99432990 TTTTATTTAATTAAATCATCAGG No data
1057958553_1057958560 21 Left 1057958553 9:99432945-99432967 CCACCCCCCTTCTGCTTTGGGTG No data
Right 1057958560 9:99432989-99433011 GGTGCCCAGTCACCCAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057958553 Original CRISPR CACCCAAAGCAGAAGGGGGG TGG (reversed) Intergenic