ID: 1057958556

View in Genome Browser
Species Human (GRCh38)
Location 9:99432950-99432972
Sequence TAAAACACCCAAAGCAGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057958556_1057958560 16 Left 1057958556 9:99432950-99432972 CCCCTTCTGCTTTGGGTGTTTTA No data
Right 1057958560 9:99432989-99433011 GGTGCCCAGTCACCCAACCCAGG No data
1057958556_1057958563 26 Left 1057958556 9:99432950-99432972 CCCCTTCTGCTTTGGGTGTTTTA No data
Right 1057958563 9:99432999-99433021 CACCCAACCCAGGAGCCAGCAGG No data
1057958556_1057958559 -5 Left 1057958556 9:99432950-99432972 CCCCTTCTGCTTTGGGTGTTTTA No data
Right 1057958559 9:99432968-99432990 TTTTATTTAATTAAATCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057958556 Original CRISPR TAAAACACCCAAAGCAGAAG GGG (reversed) Intergenic