ID: 1057958557

View in Genome Browser
Species Human (GRCh38)
Location 9:99432951-99432973
Sequence ATAAAACACCCAAAGCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057958557_1057958559 -6 Left 1057958557 9:99432951-99432973 CCCTTCTGCTTTGGGTGTTTTAT No data
Right 1057958559 9:99432968-99432990 TTTTATTTAATTAAATCATCAGG No data
1057958557_1057958563 25 Left 1057958557 9:99432951-99432973 CCCTTCTGCTTTGGGTGTTTTAT No data
Right 1057958563 9:99432999-99433021 CACCCAACCCAGGAGCCAGCAGG No data
1057958557_1057958560 15 Left 1057958557 9:99432951-99432973 CCCTTCTGCTTTGGGTGTTTTAT No data
Right 1057958560 9:99432989-99433011 GGTGCCCAGTCACCCAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057958557 Original CRISPR ATAAAACACCCAAAGCAGAA GGG (reversed) Intergenic
No off target data available for this crispr