ID: 1057958559

View in Genome Browser
Species Human (GRCh38)
Location 9:99432968-99432990
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057958553_1057958559 0 Left 1057958553 9:99432945-99432967 CCACCCCCCTTCTGCTTTGGGTG No data
Right 1057958559 9:99432968-99432990 TTTTATTTAATTAAATCATCAGG No data
1057958558_1057958559 -7 Left 1057958558 9:99432952-99432974 CCTTCTGCTTTGGGTGTTTTATT No data
Right 1057958559 9:99432968-99432990 TTTTATTTAATTAAATCATCAGG No data
1057958556_1057958559 -5 Left 1057958556 9:99432950-99432972 CCCCTTCTGCTTTGGGTGTTTTA No data
Right 1057958559 9:99432968-99432990 TTTTATTTAATTAAATCATCAGG No data
1057958554_1057958559 -3 Left 1057958554 9:99432948-99432970 CCCCCCTTCTGCTTTGGGTGTTT No data
Right 1057958559 9:99432968-99432990 TTTTATTTAATTAAATCATCAGG No data
1057958557_1057958559 -6 Left 1057958557 9:99432951-99432973 CCCTTCTGCTTTGGGTGTTTTAT No data
Right 1057958559 9:99432968-99432990 TTTTATTTAATTAAATCATCAGG No data
1057958552_1057958559 1 Left 1057958552 9:99432944-99432966 CCCACCCCCCTTCTGCTTTGGGT No data
Right 1057958559 9:99432968-99432990 TTTTATTTAATTAAATCATCAGG No data
1057958555_1057958559 -4 Left 1057958555 9:99432949-99432971 CCCCCTTCTGCTTTGGGTGTTTT No data
Right 1057958559 9:99432968-99432990 TTTTATTTAATTAAATCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057958559 Original CRISPR TTTTATTTAATTAAATCATC AGG Intergenic