ID: 1057958563

View in Genome Browser
Species Human (GRCh38)
Location 9:99432999-99433021
Sequence CACCCAACCCAGGAGCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057958556_1057958563 26 Left 1057958556 9:99432950-99432972 CCCCTTCTGCTTTGGGTGTTTTA No data
Right 1057958563 9:99432999-99433021 CACCCAACCCAGGAGCCAGCAGG No data
1057958558_1057958563 24 Left 1057958558 9:99432952-99432974 CCTTCTGCTTTGGGTGTTTTATT No data
Right 1057958563 9:99432999-99433021 CACCCAACCCAGGAGCCAGCAGG No data
1057958557_1057958563 25 Left 1057958557 9:99432951-99432973 CCCTTCTGCTTTGGGTGTTTTAT No data
Right 1057958563 9:99432999-99433021 CACCCAACCCAGGAGCCAGCAGG No data
1057958555_1057958563 27 Left 1057958555 9:99432949-99432971 CCCCCTTCTGCTTTGGGTGTTTT No data
Right 1057958563 9:99432999-99433021 CACCCAACCCAGGAGCCAGCAGG No data
1057958554_1057958563 28 Left 1057958554 9:99432948-99432970 CCCCCCTTCTGCTTTGGGTGTTT No data
Right 1057958563 9:99432999-99433021 CACCCAACCCAGGAGCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057958563 Original CRISPR CACCCAACCCAGGAGCCAGC AGG Intergenic
No off target data available for this crispr