ID: 1057962558

View in Genome Browser
Species Human (GRCh38)
Location 9:99470658-99470680
Sequence CTGCCCCAACCCATGGAAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057962558_1057962561 -5 Left 1057962558 9:99470658-99470680 CCGATTTCCATGGGTTGGGGCAG No data
Right 1057962561 9:99470676-99470698 GGCAGGAATAGAGAGCCACAAGG No data
1057962558_1057962562 4 Left 1057962558 9:99470658-99470680 CCGATTTCCATGGGTTGGGGCAG No data
Right 1057962562 9:99470685-99470707 AGAGAGCCACAAGGAACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057962558 Original CRISPR CTGCCCCAACCCATGGAAAT CGG (reversed) Intergenic
No off target data available for this crispr