ID: 1057963921

View in Genome Browser
Species Human (GRCh38)
Location 9:99484902-99484924
Sequence GCTGTGTGCACGGCTCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057963917_1057963921 -5 Left 1057963917 9:99484884-99484906 CCAGAAACAACACATCCCGCTGT No data
Right 1057963921 9:99484902-99484924 GCTGTGTGCACGGCTCATTTTGG No data
1057963914_1057963921 17 Left 1057963914 9:99484862-99484884 CCAGTCACGATGAACCGCCAGTC No data
Right 1057963921 9:99484902-99484924 GCTGTGTGCACGGCTCATTTTGG No data
1057963915_1057963921 3 Left 1057963915 9:99484876-99484898 CCGCCAGTCCAGAAACAACACAT No data
Right 1057963921 9:99484902-99484924 GCTGTGTGCACGGCTCATTTTGG No data
1057963916_1057963921 0 Left 1057963916 9:99484879-99484901 CCAGTCCAGAAACAACACATCCC No data
Right 1057963921 9:99484902-99484924 GCTGTGTGCACGGCTCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057963921 Original CRISPR GCTGTGTGCACGGCTCATTT TGG Intergenic
No off target data available for this crispr