ID: 1057966884

View in Genome Browser
Species Human (GRCh38)
Location 9:99512960-99512982
Sequence GAAGCATCCTTGACCCCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057966881_1057966884 29 Left 1057966881 9:99512908-99512930 CCAGCATTTAGATTAATGTCTGG No data
Right 1057966884 9:99512960-99512982 GAAGCATCCTTGACCCCATAAGG No data
1057966880_1057966884 30 Left 1057966880 9:99512907-99512929 CCCAGCATTTAGATTAATGTCTG No data
Right 1057966884 9:99512960-99512982 GAAGCATCCTTGACCCCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057966884 Original CRISPR GAAGCATCCTTGACCCCATA AGG Intergenic
No off target data available for this crispr