ID: 1057967455

View in Genome Browser
Species Human (GRCh38)
Location 9:99517967-99517989
Sequence CACTCCCTCCAGAGGCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057967455_1057967460 3 Left 1057967455 9:99517967-99517989 CCCTAGAGCCTCTGGAGGGAGTG No data
Right 1057967460 9:99517993-99518015 GTCGCAGACACCTTGATTTTAGG No data
1057967455_1057967461 10 Left 1057967455 9:99517967-99517989 CCCTAGAGCCTCTGGAGGGAGTG No data
Right 1057967461 9:99518000-99518022 ACACCTTGATTTTAGGTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057967455 Original CRISPR CACTCCCTCCAGAGGCTCTA GGG (reversed) Intergenic
No off target data available for this crispr