ID: 1057974129

View in Genome Browser
Species Human (GRCh38)
Location 9:99586028-99586050
Sequence CAACCATGCTTGGCACATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057974129 Original CRISPR CAACCATGCTTGGCACATAC TGG Intergenic
901448103 1:9320214-9320236 GAACAATGCTTGGCACACAGTGG - Intronic
902869696 1:19306717-19306739 CCACCATGCCTGGCCCATCCTGG + Intronic
902894124 1:19467161-19467183 CCACCATGCCTGGCAACTACGGG + Intronic
903497974 1:23783740-23783762 CCACCACGCCTGGCCCATACTGG + Intronic
909901696 1:81145509-81145531 CAACTATTCTGGGCACATAATGG + Intergenic
910144843 1:84067770-84067792 GAACCAGGCTTGGCACACTCAGG - Intergenic
910401040 1:86838475-86838497 CCACCATGCTTGGCTTCTACTGG - Intergenic
911389220 1:97217791-97217813 CAACAATGATTGGCACATCAGGG - Intronic
912739952 1:112185105-112185127 CAACAGTGCTTGGCATATAGTGG + Intergenic
915981424 1:160422346-160422368 CCACCATTTTTGGCACATAGAGG + Intronic
916661844 1:166929494-166929516 AAACCATGCTTTACACATAGTGG + Intronic
916957262 1:169851704-169851726 CAACCATACTAGGCAAATTCTGG - Intronic
917625019 1:176836899-176836921 TAACAATGCCTGGCACATATAGG + Intronic
917928833 1:179810078-179810100 ACACCATGCCTGACACATACCGG - Intronic
919102225 1:193108836-193108858 CTACAGTGCTTGGCACATAGTGG - Intergenic
922300455 1:224294875-224294897 CAAGCATGCATGGCACATCCAGG + Intronic
924525872 1:244847789-244847811 CAATCATTCTTTGCATATACTGG + Intronic
1064278420 10:13928948-13928970 CAAGCATGTTTGGAACAAACTGG - Intronic
1065884133 10:30061893-30061915 GCACCATGCTGGGCACATAGAGG - Intronic
1066384283 10:34929017-34929039 CCACCATGCCTGGCCCATACTGG + Intergenic
1070364793 10:75726136-75726158 CATCCATGCCTTCCACATACAGG - Intronic
1072193142 10:93092434-93092456 CCACCATGCCTGGCACATAAAGG + Intergenic
1072751188 10:97980008-97980030 TAACCAAGCTTGGGACACACTGG + Intronic
1075544166 10:123341801-123341823 AAACCAAGGCTGGCACATACAGG + Intergenic
1077105106 11:838783-838805 CAACCATCCCTGCCACATACAGG + Exonic
1078078035 11:8179170-8179192 CAAGCAAGCTTAACACATACAGG - Intergenic
1078747892 11:14132641-14132663 CCACTGTGCTTGGCACATAATGG + Intronic
1079339911 11:19603297-19603319 GAAACATGCCTGGCACATAGTGG - Intronic
1080526521 11:33126787-33126809 CAATAATGCTTGGCATATAATGG - Intronic
1080680597 11:34472366-34472388 CAACCATGATAGGCAAATATGGG - Intergenic
1081771621 11:45653729-45653751 GAACAGTGCCTGGCACATACAGG - Intronic
1082857410 11:57820742-57820764 CCACCATGCCTGGCCCATCCAGG + Intergenic
1083129837 11:60614996-60615018 GAACAATGCCTAGCACATACTGG + Intergenic
1084931964 11:72563003-72563025 GAACCATCATTGGCCCATACAGG + Intergenic
1087011256 11:93516200-93516222 GAACCATGCTTGGCAGGTCCCGG + Intronic
1087708228 11:101519941-101519963 CAAGCAAGCTTGGTACATAGAGG - Intronic
1088079899 11:105899319-105899341 CAACAGTGCTTGACACATAGTGG - Intronic
1090816567 11:130302110-130302132 GAACAATACTTGGCACATATTGG - Intronic
1091719577 12:2803013-2803035 CCACCAGGCTTGGCCTATACAGG + Intronic
1093274139 12:17103070-17103092 CTACCATGCTTAGAACATATTGG - Intergenic
1097346587 12:58499973-58499995 GCACCATGTCTGGCACATACAGG - Intergenic
1098845348 12:75528518-75528540 CATCTCTGCTTGGCACAGACTGG + Intergenic
1101549709 12:105750563-105750585 GAACAATCCTTGGCACATATTGG - Intergenic
1103480413 12:121246877-121246899 CACCTATGCCTGGCACACACTGG + Intronic
1108497927 13:51043404-51043426 GCAACATGCATGGCACATACTGG - Intergenic
1109245731 13:59952872-59952894 GAAGAATGCTTGGCACATATGGG - Intronic
1112136529 13:96584534-96584556 GGACCATGCCTGGCACATAGAGG + Intronic
1112524047 13:100126595-100126617 CAACCATGCTGGGCACAGAATGG - Intronic
1113527402 13:110991831-110991853 CATCCATGCTTGGCTGATGCTGG - Intergenic
1119228886 14:72964685-72964707 CAACAATGAATGGCACACACTGG + Intergenic
1120036640 14:79705613-79705635 CAGGCACGCTTGGCACATTCAGG - Intronic
1120643290 14:87041502-87041524 GAATCATACTTGGAACATACAGG + Intergenic
1121027819 14:90629530-90629552 CAAGCATGCATTGCACAGACAGG + Intronic
1121208886 14:92191583-92191605 CAACAGTGCCTGGCACATAGTGG - Intergenic
1121231952 14:92364832-92364854 CAAGCATGTCTGGCACAGACTGG + Intronic
1122829455 14:104388713-104388735 CAACCAGGCTTGCAACATCCAGG + Intergenic
1126133725 15:45370087-45370109 CAACCATGCCTGGCCAATAATGG - Intronic
1128398168 15:67250462-67250484 CCACCATGCCTGGCACATGGAGG + Intronic
1129436789 15:75547951-75547973 CCACCATGCCTGGCCCCTACTGG + Intronic
1132105959 15:99062805-99062827 CACACATGCCTGGCACATGCAGG - Intergenic
1134334590 16:13286240-13286262 CAACCACGCTGAGCACATATAGG + Intergenic
1135956573 16:26961040-26961062 CTACCATGCCTGGCACAGAGCGG - Intergenic
1136272986 16:29159335-29159357 CCACCATGCATGGTACATAGCGG - Intergenic
1138759476 16:59524456-59524478 CTACCATGTTTTGTACATACTGG + Intergenic
1141468689 16:84223797-84223819 GAACCATGCCTGGCACAAAGTGG - Intronic
1141792631 16:86246919-86246941 CAACGGTGCTTGGCACATGTAGG - Intergenic
1142477282 17:196455-196477 CAGCAGTGCTTGGCACATGCAGG - Intergenic
1142774404 17:2124894-2124916 CAACCATGATTGGCACCGAAAGG + Intronic
1143948393 17:10614260-10614282 GAACAGTGCTTGGCACATAGAGG + Intergenic
1146634713 17:34495338-34495360 TATCCATGCATGGCATATACAGG + Intergenic
1148003270 17:44403358-44403380 CCACCATGCTCGGCCCATGCTGG + Intronic
1148995452 17:51705474-51705496 AAACAGTGCTTGGCACATACAGG + Intronic
1149825335 17:59823160-59823182 CCACCATGCCTGGCCCATTCAGG - Intronic
1150778692 17:68101766-68101788 CGACGACGCTTGGCACATCCGGG + Intergenic
1152722992 17:81931916-81931938 GAACCATGCTTGGTATATATGGG - Intergenic
1155082375 18:22423544-22423566 GAACGCTGCTTGGCACATATGGG - Intergenic
1156333448 18:36147776-36147798 AAACAAGGCCTGGCACATACTGG + Intronic
1160058085 18:75504899-75504921 CAACAATGCTTTGCACATTGTGG - Intergenic
1161227955 19:3156057-3156079 TAGCCATGCTGGGCACACACAGG - Intronic
1164445394 19:28313434-28313456 CCAACATGCTTGGCACTTTCGGG - Intergenic
1167899699 19:52610568-52610590 CCACCATGCCTGGCCCATTCTGG + Intronic
1168357435 19:55710796-55710818 CCACCATGCCTGGCAGAGACTGG - Intronic
925294553 2:2768588-2768610 GAACCCTGCTTGGGACAGACGGG - Intergenic
926180217 2:10636173-10636195 CCACCATGCCTGGCCCATCCAGG + Intronic
927541328 2:23913979-23914001 CCACCATGCCTGGTCCATACTGG - Intronic
927605386 2:24482285-24482307 GAATAATGCTTGGCCCATACTGG + Intergenic
929580048 2:43076294-43076316 CATCCCTGCTGGCCACATACTGG + Intergenic
930344927 2:50168212-50168234 CAAGCATGCATTGCAAATACTGG + Intronic
936566437 2:113585968-113585990 TAACCATACTTGGGATATACTGG - Intergenic
937463532 2:122109945-122109967 CTCCCATGCTAGGCACAGACAGG + Intergenic
939197936 2:138996087-138996109 CAACCATGCTGGCAACATGCTGG + Intergenic
943559356 2:189442269-189442291 CAACAATGCCCGGCACATAATGG + Intronic
944013465 2:195002725-195002747 AAATCATGCTTGCCACTTACAGG - Intergenic
944898780 2:204193454-204193476 CTCACATGCTTGGCTCATACTGG - Intergenic
945854707 2:215055163-215055185 CCACAATTCCTGGCACATACTGG - Intronic
946568866 2:220998935-220998957 CAGCCATGCTTGAAATATACTGG - Intergenic
947496686 2:230642940-230642962 TCACCCTGCTTGGCAAATACAGG + Intergenic
947864486 2:233386815-233386837 TCACCATGATTGGCACATGCTGG + Intronic
947947782 2:234121260-234121282 CTCCCATGCTGGGCACAAACAGG - Intergenic
1169440704 20:5631634-5631656 CAGCAATGCTTGGCACTTATTGG + Intergenic
1170758371 20:19225428-19225450 CCACAATGCTTGGAAAATACCGG - Intronic
1171349735 20:24493405-24493427 CACACATGCTTGGCACACACAGG + Intronic
1172397035 20:34615308-34615330 AAACAATGCTTGGAACATAGTGG - Intronic
1172599596 20:36174701-36174723 CCACCATGCTTGGCCCATTGTGG + Intronic
1172681867 20:36722540-36722562 AAACTATGCTTGGAACAGACTGG + Intronic
1175615056 20:60390716-60390738 CAACTGTGCCTGGCACATAAAGG - Intergenic
1178564361 21:33669368-33669390 CCACCATGCCTGGCCCAAACTGG + Intronic
1179835667 21:44030878-44030900 CAACAAGGCATGGCACATAGTGG - Intronic
1182034989 22:27191055-27191077 CTTCAATGCTTGGCACATATAGG + Intergenic
1182309522 22:29394689-29394711 CAACGATGCTTGGCCCATGGTGG - Intronic
1182846484 22:33435287-33435309 CCACCATGCCTGGCTCCTACGGG + Intronic
1183399459 22:37593563-37593585 CCACCATGCCTGGCCTATACTGG + Intergenic
1183999236 22:41660139-41660161 CCTCCATGCTTGGCAAATACGGG + Intronic
1184386756 22:44181154-44181176 GAACAATGCTTGGCACAAAGTGG - Exonic
949582502 3:5403199-5403221 CTACCCTGCTTGGTACATATAGG - Intergenic
949941121 3:9155510-9155532 GAACTCTGCTTGGCATATACTGG + Intronic
950500601 3:13361229-13361251 GAACCATGCCTGGCACATAGCGG + Intronic
953527479 3:43705076-43705098 ACACCATGGTTGGCACATAGTGG + Intronic
954671935 3:52295721-52295743 CAACCATGCTTGGCCTCTCCAGG + Intergenic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955444133 3:58991013-58991035 CAACTTTACTTGGCACATAGTGG + Intronic
956090645 3:65663039-65663061 TACCCATGCCTAGCACATACTGG + Intronic
960095788 3:113688618-113688640 GAATCATGCTAGGCACATAGTGG + Intronic
965534285 3:169809041-169809063 CTACCAGGCCTGGCACATAATGG - Intronic
967649347 3:191966374-191966396 CAACCATGTATGGCACATAAGGG + Intergenic
968096165 3:195932271-195932293 CAACATTTCTAGGCACATACTGG + Intergenic
969456656 4:7304101-7304123 CACACATGCCTGGCACATATAGG - Intronic
970231086 4:13911895-13911917 CAGCCATGCTTAGCACCTTCAGG - Intergenic
970246110 4:14065637-14065659 CACCAATGCCTGGCACATAATGG - Intergenic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
976601931 4:86945777-86945799 CCACCATGCTTGGCCCATGGAGG + Intronic
978001937 4:103566778-103566800 CAGCCATGCTAGACACATAATGG - Intergenic
982223482 4:153144360-153144382 TACCCATACCTGGCACATACTGG - Intergenic
986120765 5:4834237-4834259 CACCAATGCTTGGCACATAGTGG - Intergenic
988513671 5:31887043-31887065 CAACTATGCATGGCACAGCCTGG - Intronic
989744538 5:44812361-44812383 CCACCATGCATGGCACAAATAGG - Intronic
990759123 5:59109218-59109240 GAACAATGTATGGCACATACAGG - Intronic
990794008 5:59519498-59519520 AGAACATGCTTGGCACATTCAGG + Intronic
990924827 5:61008679-61008701 CAACCATTTGTGGCACATATTGG + Intronic
993034079 5:82737709-82737731 CAACCATGCTTCACACAGAAAGG + Intergenic
995323231 5:110860692-110860714 CAAAGATGCTTGGGACATCCAGG - Intergenic
1000961793 5:167609366-167609388 CAGCCATGCGTGGCCCACACAGG - Intronic
1002003120 5:176209676-176209698 CCACCATGCCTGGCATAGACTGG + Intergenic
1002223344 5:177701274-177701296 CCACCATGCCTGGCATAGACTGG - Intergenic
1003940302 6:11017856-11017878 GAACAATGCCTGGCACATAATGG + Intronic
1007163992 6:39815304-39815326 CCACCATGCTTGTCACCTAGGGG - Intronic
1008541084 6:52546912-52546934 CAACAGCGCTTGGCACATAGTGG + Intronic
1009386931 6:63096308-63096330 CCACCATGCCTGGCCCATATGGG - Intergenic
1010218563 6:73427586-73427608 CCACCATGCCTGGCCAATACTGG + Intronic
1013241972 6:108254584-108254606 CAACACTGCTTGGCACATAGTGG - Intronic
1014888108 6:126807031-126807053 ACACCATGTCTGGCACATACCGG + Intergenic
1015047521 6:128794179-128794201 CCACCATGCCTGGCTCATCCCGG - Intergenic
1015257119 6:131190964-131190986 ATACTGTGCTTGGCACATACAGG + Intronic
1017557402 6:155586591-155586613 TAATCTTGCTTGGCAGATACTGG - Intergenic
1017570447 6:155738777-155738799 CACCCAGGCTTGGCACATTTTGG + Intergenic
1017791216 6:157801439-157801461 CTACCATGCCTGGCACACAGTGG - Intronic
1017813728 6:158002180-158002202 GAACCATGCCTGGCACACAGTGG + Intronic
1022457037 7:30566536-30566558 CCACCATGCTTGGCTCATTTTGG + Intergenic
1025247461 7:57328115-57328137 GAAGCATGCTTGGCACACAGTGG + Intergenic
1026406269 7:70069310-70069332 CAATCTTGCTTGGCACATCCTGG - Intronic
1028515404 7:91672765-91672787 CTACCATGCCTGGCCCAGACTGG - Intergenic
1029237399 7:99132352-99132374 CAACACTGCTTGGCACCTGCTGG - Intronic
1029626188 7:101721717-101721739 CCACCGTGCCTGGCACAAACCGG - Intergenic
1029923413 7:104290432-104290454 GCACAATGCTTGGCACATAATGG - Intergenic
1033454732 7:141492489-141492511 GCACAATGCCTGGCACATACTGG + Intergenic
1033907471 7:146223042-146223064 CAACAGTGCCTGGCACATATAGG - Intronic
1034946508 7:155265828-155265850 CAACCGTGTTTGGCACACGCAGG - Intergenic
1036062675 8:5341919-5341941 GCACAATGCATGGCACATACAGG - Intergenic
1039591795 8:38756245-38756267 CCAACATGCTTGGCACACAGTGG - Intronic
1040045081 8:42954670-42954692 CTACAGTGCTTGGTACATACTGG - Intronic
1041413660 8:57583817-57583839 GAAGGATGTTTGGCACATACTGG - Intergenic
1041619010 8:59943409-59943431 CAACTCTGCCTGGCACATAGAGG - Intergenic
1044840446 8:96332606-96332628 CAAACAACCTTGGCACTTACAGG + Intronic
1047734189 8:127751452-127751474 CGCCCATGCTTAGCACAGACTGG + Intergenic
1048980078 8:139698521-139698543 CCACCCTGCTTAGCACATGCAGG - Intronic
1049243480 8:141550224-141550246 TCACCGTGCTTGGCAGATACAGG - Intergenic
1050762100 9:9084944-9084966 CAACCATTTTTAGCACAGACAGG + Intronic
1051064889 9:13091554-13091576 CAAACAAGATTGGCATATACTGG - Intergenic
1052083985 9:24241266-24241288 TAACTATGCCTGGAACATACTGG - Intergenic
1054895991 9:70311968-70311990 CCACCATGCTAGGCTAATACAGG - Intronic
1057974129 9:99586028-99586050 CAACCATGCTTGGCACATACTGG + Intergenic
1058008955 9:99953278-99953300 GCACAATGCTTGGCACATAATGG + Intronic
1059616516 9:115957637-115957659 CAAACATGCTTGTAACATATGGG + Intergenic
1061294194 9:129667955-129667977 CAGGCATGCTTGGGACACACTGG + Intronic
1062523534 9:136969363-136969385 CACCCATGCTGGGCACACAGTGG + Exonic
1062621723 9:137425741-137425763 CAACCTTGGCTGTCACATACTGG - Intronic
1188308003 X:28582477-28582499 GAACCATGCCTGGCACATAGTGG + Intergenic
1189217753 X:39341722-39341744 TGAGCATGCTTGGCACATGCAGG + Intergenic
1189738226 X:44092848-44092870 AAAACATGCTTGGCATATAGTGG + Intergenic
1192259736 X:69498076-69498098 CCACCATGCCTGGCCCACACTGG - Intergenic
1200095354 X:153656992-153657014 CCACCAAGCTAGGCAGATACAGG - Intergenic