ID: 1057974297

View in Genome Browser
Species Human (GRCh38)
Location 9:99587905-99587927
Sequence CAATTCCCATTAAAGAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057974295_1057974297 -3 Left 1057974295 9:99587885-99587907 CCAGGGAAGGATGTGGACAGCAA No data
Right 1057974297 9:99587905-99587927 CAATTCCCATTAAAGAACCAGGG No data
1057974288_1057974297 19 Left 1057974288 9:99587863-99587885 CCCCTTGTATGTTTTATCTTAGC No data
Right 1057974297 9:99587905-99587927 CAATTCCCATTAAAGAACCAGGG No data
1057974289_1057974297 18 Left 1057974289 9:99587864-99587886 CCCTTGTATGTTTTATCTTAGCC No data
Right 1057974297 9:99587905-99587927 CAATTCCCATTAAAGAACCAGGG No data
1057974290_1057974297 17 Left 1057974290 9:99587865-99587887 CCTTGTATGTTTTATCTTAGCCA No data
Right 1057974297 9:99587905-99587927 CAATTCCCATTAAAGAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057974297 Original CRISPR CAATTCCCATTAAAGAACCA GGG Intergenic
No off target data available for this crispr