ID: 1057982785

View in Genome Browser
Species Human (GRCh38)
Location 9:99679225-99679247
Sequence CACTTCATTGGTTCCTACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057982783_1057982785 14 Left 1057982783 9:99679188-99679210 CCTTCATCTGATTCTTTTCTTTC No data
Right 1057982785 9:99679225-99679247 CACTTCATTGGTTCCTACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057982785 Original CRISPR CACTTCATTGGTTCCTACTC TGG Intergenic
No off target data available for this crispr