ID: 1057985571

View in Genome Browser
Species Human (GRCh38)
Location 9:99710337-99710359
Sequence ACCTGGGTCTAAAGTTAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057985571_1057985577 11 Left 1057985571 9:99710337-99710359 CCTGTTTAACTTTAGACCCAGGT No data
Right 1057985577 9:99710371-99710393 CATCACTTGGAAATCTGTCCTGG No data
1057985571_1057985576 -2 Left 1057985571 9:99710337-99710359 CCTGTTTAACTTTAGACCCAGGT No data
Right 1057985576 9:99710358-99710380 GTGGTGTGGCACACATCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057985571 Original CRISPR ACCTGGGTCTAAAGTTAAAC AGG (reversed) Intergenic
No off target data available for this crispr