ID: 1057985576

View in Genome Browser
Species Human (GRCh38)
Location 9:99710358-99710380
Sequence GTGGTGTGGCACACATCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057985569_1057985576 -1 Left 1057985569 9:99710336-99710358 CCCTGTTTAACTTTAGACCCAGG No data
Right 1057985576 9:99710358-99710380 GTGGTGTGGCACACATCACTTGG No data
1057985567_1057985576 24 Left 1057985567 9:99710311-99710333 CCATATACTAACTTGAAATCTTC No data
Right 1057985576 9:99710358-99710380 GTGGTGTGGCACACATCACTTGG No data
1057985568_1057985576 2 Left 1057985568 9:99710333-99710355 CCTCCCTGTTTAACTTTAGACCC No data
Right 1057985576 9:99710358-99710380 GTGGTGTGGCACACATCACTTGG No data
1057985571_1057985576 -2 Left 1057985571 9:99710337-99710359 CCTGTTTAACTTTAGACCCAGGT No data
Right 1057985576 9:99710358-99710380 GTGGTGTGGCACACATCACTTGG No data
1057985566_1057985576 29 Left 1057985566 9:99710306-99710328 CCATACCATATACTAACTTGAAA No data
Right 1057985576 9:99710358-99710380 GTGGTGTGGCACACATCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057985576 Original CRISPR GTGGTGTGGCACACATCACT TGG Intergenic
No off target data available for this crispr