ID: 1057985577

View in Genome Browser
Species Human (GRCh38)
Location 9:99710371-99710393
Sequence CATCACTTGGAAATCTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057985574_1057985577 -5 Left 1057985574 9:99710353-99710375 CCCAGGTGGTGTGGCACACATCA No data
Right 1057985577 9:99710371-99710393 CATCACTTGGAAATCTGTCCTGG No data
1057985571_1057985577 11 Left 1057985571 9:99710337-99710359 CCTGTTTAACTTTAGACCCAGGT No data
Right 1057985577 9:99710371-99710393 CATCACTTGGAAATCTGTCCTGG No data
1057985575_1057985577 -6 Left 1057985575 9:99710354-99710376 CCAGGTGGTGTGGCACACATCAC No data
Right 1057985577 9:99710371-99710393 CATCACTTGGAAATCTGTCCTGG No data
1057985568_1057985577 15 Left 1057985568 9:99710333-99710355 CCTCCCTGTTTAACTTTAGACCC No data
Right 1057985577 9:99710371-99710393 CATCACTTGGAAATCTGTCCTGG No data
1057985569_1057985577 12 Left 1057985569 9:99710336-99710358 CCCTGTTTAACTTTAGACCCAGG No data
Right 1057985577 9:99710371-99710393 CATCACTTGGAAATCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057985577 Original CRISPR CATCACTTGGAAATCTGTCC TGG Intergenic
No off target data available for this crispr