ID: 1057995008

View in Genome Browser
Species Human (GRCh38)
Location 9:99813899-99813921
Sequence CTGGTTGCCCAGATTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057995008_1057995017 22 Left 1057995008 9:99813899-99813921 CCTCCCTCAATCTGGGCAACCAG No data
Right 1057995017 9:99813944-99813966 ACGGTGGAAGAGGGTAGTGCAGG No data
1057995008_1057995016 13 Left 1057995008 9:99813899-99813921 CCTCCCTCAATCTGGGCAACCAG No data
Right 1057995016 9:99813935-99813957 CTCGGTGCAACGGTGGAAGAGGG No data
1057995008_1057995014 6 Left 1057995008 9:99813899-99813921 CCTCCCTCAATCTGGGCAACCAG No data
Right 1057995014 9:99813928-99813950 CTGTAGACTCGGTGCAACGGTGG No data
1057995008_1057995011 -5 Left 1057995008 9:99813899-99813921 CCTCCCTCAATCTGGGCAACCAG No data
Right 1057995011 9:99813917-99813939 ACCAGAAGTGTCTGTAGACTCGG No data
1057995008_1057995013 3 Left 1057995008 9:99813899-99813921 CCTCCCTCAATCTGGGCAACCAG No data
Right 1057995013 9:99813925-99813947 TGTCTGTAGACTCGGTGCAACGG No data
1057995008_1057995015 12 Left 1057995008 9:99813899-99813921 CCTCCCTCAATCTGGGCAACCAG No data
Right 1057995015 9:99813934-99813956 ACTCGGTGCAACGGTGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057995008 Original CRISPR CTGGTTGCCCAGATTGAGGG AGG (reversed) Intergenic
No off target data available for this crispr