ID: 1057995528

View in Genome Browser
Species Human (GRCh38)
Location 9:99819673-99819695
Sequence TGCGCACGGAGGTGGGGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057995528_1057995533 -10 Left 1057995528 9:99819673-99819695 CCGTCTCCCCACCTCCGTGCGCA No data
Right 1057995533 9:99819686-99819708 TCCGTGCGCACACACATGCACGG No data
1057995528_1057995535 -9 Left 1057995528 9:99819673-99819695 CCGTCTCCCCACCTCCGTGCGCA No data
Right 1057995535 9:99819687-99819709 CCGTGCGCACACACATGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057995528 Original CRISPR TGCGCACGGAGGTGGGGAGA CGG (reversed) Intergenic