ID: 1057995535

View in Genome Browser
Species Human (GRCh38)
Location 9:99819687-99819709
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057995527_1057995535 12 Left 1057995527 9:99819652-99819674 CCGCAGGGCGGGCGGGGATCACC No data
Right 1057995535 9:99819687-99819709 CCGTGCGCACACACATGCACGGG No data
1057995519_1057995535 24 Left 1057995519 9:99819640-99819662 CCGCCGGGCCTTCCGCAGGGCGG No data
Right 1057995535 9:99819687-99819709 CCGTGCGCACACACATGCACGGG No data
1057995528_1057995535 -9 Left 1057995528 9:99819673-99819695 CCGTCTCCCCACCTCCGTGCGCA No data
Right 1057995535 9:99819687-99819709 CCGTGCGCACACACATGCACGGG No data
1057995522_1057995535 21 Left 1057995522 9:99819643-99819665 CCGGGCCTTCCGCAGGGCGGGCG No data
Right 1057995535 9:99819687-99819709 CCGTGCGCACACACATGCACGGG No data
1057995526_1057995535 16 Left 1057995526 9:99819648-99819670 CCTTCCGCAGGGCGGGCGGGGAT No data
Right 1057995535 9:99819687-99819709 CCGTGCGCACACACATGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057995535 Original CRISPR CCGTGCGCACACACATGCAC GGG Intergenic
No off target data available for this crispr