ID: 1057995727

View in Genome Browser
Species Human (GRCh38)
Location 9:99820531-99820553
Sequence GGCGGGGGGCGCTGCGCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057995727_1057995739 1 Left 1057995727 9:99820531-99820553 CCCTCGGCGCAGCGCCCCCCGCC No data
Right 1057995739 9:99820555-99820577 CCGCCACACACACACAAATTGGG No data
1057995727_1057995742 23 Left 1057995727 9:99820531-99820553 CCCTCGGCGCAGCGCCCCCCGCC No data
Right 1057995742 9:99820577-99820599 GACAGGTCAAACATATAAAACGG No data
1057995727_1057995741 6 Left 1057995727 9:99820531-99820553 CCCTCGGCGCAGCGCCCCCCGCC No data
Right 1057995741 9:99820560-99820582 ACACACACACAAATTGGGACAGG No data
1057995727_1057995737 0 Left 1057995727 9:99820531-99820553 CCCTCGGCGCAGCGCCCCCCGCC No data
Right 1057995737 9:99820554-99820576 CCCGCCACACACACACAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057995727 Original CRISPR GGCGGGGGGCGCTGCGCCGA GGG (reversed) Intergenic
No off target data available for this crispr