ID: 1057995728

View in Genome Browser
Species Human (GRCh38)
Location 9:99820532-99820554
Sequence GGGCGGGGGGCGCTGCGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057995728_1057995737 -1 Left 1057995728 9:99820532-99820554 CCTCGGCGCAGCGCCCCCCGCCC No data
Right 1057995737 9:99820554-99820576 CCCGCCACACACACACAAATTGG No data
1057995728_1057995741 5 Left 1057995728 9:99820532-99820554 CCTCGGCGCAGCGCCCCCCGCCC No data
Right 1057995741 9:99820560-99820582 ACACACACACAAATTGGGACAGG No data
1057995728_1057995742 22 Left 1057995728 9:99820532-99820554 CCTCGGCGCAGCGCCCCCCGCCC No data
Right 1057995742 9:99820577-99820599 GACAGGTCAAACATATAAAACGG No data
1057995728_1057995739 0 Left 1057995728 9:99820532-99820554 CCTCGGCGCAGCGCCCCCCGCCC No data
Right 1057995739 9:99820555-99820577 CCGCCACACACACACAAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057995728 Original CRISPR GGGCGGGGGGCGCTGCGCCG AGG (reversed) Intergenic