ID: 1057995737

View in Genome Browser
Species Human (GRCh38)
Location 9:99820554-99820576
Sequence CCCGCCACACACACACAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057995728_1057995737 -1 Left 1057995728 9:99820532-99820554 CCTCGGCGCAGCGCCCCCCGCCC No data
Right 1057995737 9:99820554-99820576 CCCGCCACACACACACAAATTGG No data
1057995726_1057995737 1 Left 1057995726 9:99820530-99820552 CCCCTCGGCGCAGCGCCCCCCGC No data
Right 1057995737 9:99820554-99820576 CCCGCCACACACACACAAATTGG No data
1057995727_1057995737 0 Left 1057995727 9:99820531-99820553 CCCTCGGCGCAGCGCCCCCCGCC No data
Right 1057995737 9:99820554-99820576 CCCGCCACACACACACAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057995737 Original CRISPR CCCGCCACACACACACAAAT TGG Intergenic