ID: 1057995741

View in Genome Browser
Species Human (GRCh38)
Location 9:99820560-99820582
Sequence ACACACACACAAATTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057995729_1057995741 -8 Left 1057995729 9:99820545-99820567 CCCCCCGCCCCCGCCACACACAC No data
Right 1057995741 9:99820560-99820582 ACACACACACAAATTGGGACAGG No data
1057995727_1057995741 6 Left 1057995727 9:99820531-99820553 CCCTCGGCGCAGCGCCCCCCGCC No data
Right 1057995741 9:99820560-99820582 ACACACACACAAATTGGGACAGG No data
1057995730_1057995741 -9 Left 1057995730 9:99820546-99820568 CCCCCGCCCCCGCCACACACACA No data
Right 1057995741 9:99820560-99820582 ACACACACACAAATTGGGACAGG No data
1057995726_1057995741 7 Left 1057995726 9:99820530-99820552 CCCCTCGGCGCAGCGCCCCCCGC No data
Right 1057995741 9:99820560-99820582 ACACACACACAAATTGGGACAGG No data
1057995731_1057995741 -10 Left 1057995731 9:99820547-99820569 CCCCGCCCCCGCCACACACACAC No data
Right 1057995741 9:99820560-99820582 ACACACACACAAATTGGGACAGG No data
1057995728_1057995741 5 Left 1057995728 9:99820532-99820554 CCTCGGCGCAGCGCCCCCCGCCC No data
Right 1057995741 9:99820560-99820582 ACACACACACAAATTGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057995741 Original CRISPR ACACACACACAAATTGGGAC AGG Intergenic