ID: 1057995742

View in Genome Browser
Species Human (GRCh38)
Location 9:99820577-99820599
Sequence GACAGGTCAAACATATAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057995734_1057995742 2 Left 1057995734 9:99820552-99820574 CCCCCGCCACACACACACAAATT No data
Right 1057995742 9:99820577-99820599 GACAGGTCAAACATATAAAACGG No data
1057995730_1057995742 8 Left 1057995730 9:99820546-99820568 CCCCCGCCCCCGCCACACACACA No data
Right 1057995742 9:99820577-99820599 GACAGGTCAAACATATAAAACGG No data
1057995732_1057995742 6 Left 1057995732 9:99820548-99820570 CCCGCCCCCGCCACACACACACA No data
Right 1057995742 9:99820577-99820599 GACAGGTCAAACATATAAAACGG No data
1057995740_1057995742 -4 Left 1057995740 9:99820558-99820580 CCACACACACACAAATTGGGACA No data
Right 1057995742 9:99820577-99820599 GACAGGTCAAACATATAAAACGG No data
1057995736_1057995742 0 Left 1057995736 9:99820554-99820576 CCCGCCACACACACACAAATTGG No data
Right 1057995742 9:99820577-99820599 GACAGGTCAAACATATAAAACGG No data
1057995726_1057995742 24 Left 1057995726 9:99820530-99820552 CCCCTCGGCGCAGCGCCCCCCGC No data
Right 1057995742 9:99820577-99820599 GACAGGTCAAACATATAAAACGG No data
1057995727_1057995742 23 Left 1057995727 9:99820531-99820553 CCCTCGGCGCAGCGCCCCCCGCC No data
Right 1057995742 9:99820577-99820599 GACAGGTCAAACATATAAAACGG No data
1057995731_1057995742 7 Left 1057995731 9:99820547-99820569 CCCCGCCCCCGCCACACACACAC No data
Right 1057995742 9:99820577-99820599 GACAGGTCAAACATATAAAACGG No data
1057995738_1057995742 -1 Left 1057995738 9:99820555-99820577 CCGCCACACACACACAAATTGGG No data
Right 1057995742 9:99820577-99820599 GACAGGTCAAACATATAAAACGG No data
1057995735_1057995742 1 Left 1057995735 9:99820553-99820575 CCCCGCCACACACACACAAATTG No data
Right 1057995742 9:99820577-99820599 GACAGGTCAAACATATAAAACGG No data
1057995729_1057995742 9 Left 1057995729 9:99820545-99820567 CCCCCCGCCCCCGCCACACACAC No data
Right 1057995742 9:99820577-99820599 GACAGGTCAAACATATAAAACGG No data
1057995728_1057995742 22 Left 1057995728 9:99820532-99820554 CCTCGGCGCAGCGCCCCCCGCCC No data
Right 1057995742 9:99820577-99820599 GACAGGTCAAACATATAAAACGG No data
1057995733_1057995742 5 Left 1057995733 9:99820549-99820571 CCGCCCCCGCCACACACACACAA No data
Right 1057995742 9:99820577-99820599 GACAGGTCAAACATATAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057995742 Original CRISPR GACAGGTCAAACATATAAAA CGG Intergenic