ID: 1057996309

View in Genome Browser
Species Human (GRCh38)
Location 9:99823893-99823915
Sequence CCGCCCCCGCTCCCCAGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057996300_1057996309 -10 Left 1057996300 9:99823880-99823902 CCCCGCCCAACCTCCGCCCCCGC 0: 1
1: 0
2: 8
3: 102
4: 991
Right 1057996309 9:99823893-99823915 CCGCCCCCGCTCCCCAGGGTTGG No data
1057996295_1057996309 23 Left 1057996295 9:99823847-99823869 CCTTTCTGTCAGTCTCTCCCTCG 0: 1
1: 0
2: 1
3: 50
4: 572
Right 1057996309 9:99823893-99823915 CCGCCCCCGCTCCCCAGGGTTGG No data
1057996298_1057996309 -2 Left 1057996298 9:99823872-99823894 CCTCTTGCCCCCGCCCAACCTCC 0: 1
1: 0
2: 3
3: 56
4: 665
Right 1057996309 9:99823893-99823915 CCGCCCCCGCTCCCCAGGGTTGG No data
1057996299_1057996309 -9 Left 1057996299 9:99823879-99823901 CCCCCGCCCAACCTCCGCCCCCG 0: 1
1: 0
2: 3
3: 105
4: 1075
Right 1057996309 9:99823893-99823915 CCGCCCCCGCTCCCCAGGGTTGG No data
1057996296_1057996309 6 Left 1057996296 9:99823864-99823886 CCCTCGCTCCTCTTGCCCCCGCC 0: 1
1: 0
2: 2
3: 43
4: 502
Right 1057996309 9:99823893-99823915 CCGCCCCCGCTCCCCAGGGTTGG No data
1057996297_1057996309 5 Left 1057996297 9:99823865-99823887 CCTCGCTCCTCTTGCCCCCGCCC 0: 1
1: 0
2: 6
3: 91
4: 697
Right 1057996309 9:99823893-99823915 CCGCCCCCGCTCCCCAGGGTTGG No data
1057996294_1057996309 24 Left 1057996294 9:99823846-99823868 CCCTTTCTGTCAGTCTCTCCCTC 0: 1
1: 1
2: 9
3: 213
4: 1963
Right 1057996309 9:99823893-99823915 CCGCCCCCGCTCCCCAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057996309 Original CRISPR CCGCCCCCGCTCCCCAGGGT TGG Intronic
No off target data available for this crispr